Incidental Mutation 'R2254:Slc22a12'
ID241901
Institutional Source Beutler Lab
Gene Symbol Slc22a12
Ensembl Gene ENSMUSG00000061742
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 12
SynonymsRst, URAT1
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6535845-6543019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6542541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 57 (V57D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113451] [ENSMUST00000113459]
Predicted Effect probably benign
Transcript: ENSMUST00000113451
AA Change: V71D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109078
Gene: ENSMUSG00000061742
AA Change: V71D

DomainStartEndE-ValueType
Pfam:Sugar_tr 95 525 2e-26 PFAM
Pfam:MFS_1 128 484 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113459
SMART Domains Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 238 1.26e-19 SMART
low complexity region 267 297 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126142
AA Change: V57D

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114626
Gene: ENSMUSG00000061742
AA Change: V57D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 229 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153483
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urinary urate levels and altered urine and plasma metabolite composition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Slc22a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Slc22a12 APN 19 6537814 missense probably benign 0.19
IGL02586:Slc22a12 APN 19 6540457 missense probably benign 0.03
R1353:Slc22a12 UTSW 19 6537782 missense possibly damaging 0.66
R1757:Slc22a12 UTSW 19 6536731 splice site probably null
R1816:Slc22a12 UTSW 19 6542653 nonsense probably null
R4110:Slc22a12 UTSW 19 6540628 missense probably damaging 1.00
R4125:Slc22a12 UTSW 19 6538788 missense probably damaging 0.99
R4342:Slc22a12 UTSW 19 6541099 missense probably benign 0.15
R4762:Slc22a12 UTSW 19 6538444 missense probably benign 0.02
R4927:Slc22a12 UTSW 19 6537761 missense probably benign 0.23
R5690:Slc22a12 UTSW 19 6536848 missense probably benign 0.00
R5772:Slc22a12 UTSW 19 6540449 missense possibly damaging 0.67
R5946:Slc22a12 UTSW 19 6537851 missense probably damaging 1.00
R6137:Slc22a12 UTSW 19 6542724 missense probably benign 0.07
X0062:Slc22a12 UTSW 19 6537127 missense probably damaging 1.00
Z1088:Slc22a12 UTSW 19 6538463 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GTCACGATTGTGGACCTGAAGG -3'
(R):5'- ACCCATGGCCTTTCCTGAAC -3'

Sequencing Primer
(F):5'- AAGGTGCTGTGGTCGTAAAC -3'
(R):5'- TTCCTGAACTCCTGGACCGAG -3'
Posted On2014-10-16