Incidental Mutation 'R2255:Agbl1'
ID241949
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission 040255-MU
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2255 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76422184 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 581 (F581S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect probably benign
Transcript: ENSMUST00000026854
AA Change: F343S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: F343S

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107442
AA Change: F343S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: F343S

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156166
AA Change: F595S
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: F595S

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166190
AA Change: F581S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128342
Gene: ENSMUSG00000025754
AA Change: F581S

DomainStartEndE-ValueType
low complexity region 286 302 N/A INTRINSIC
Pfam:Peptidase_M14 737 871 7.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
D130043K22Rik A T 13: 24,856,911 R105S probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gapdhs G C 7: 30,729,908 probably null Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Greb1l T A 18: 10,554,857 N1634K probably damaging Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spag6l T C 16: 16,777,339 E394G probably damaging Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Wrn G A 8: 33,329,202 P241S probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp687 A T 3: 95,010,437 C675S probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACTTCTGCTTCTAAAACCAG -3'
(R):5'- CATCAACCAATAAGTTCCCTCATTGTC -3'

Sequencing Primer
(F):5'- TCTGCTTCTAAAACCAGCATGG -3'
(R):5'- TCTTTTGACAGATGACTCGGAGAAG -3'
Posted On2014-10-16