Incidental Mutation 'R0167:Golga1'
ID24206
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Namegolgi autoantigen, golgin subfamily a, 1
Synonyms0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R0167 (G1)
Quality Score216
Status Validated (trace)
Chromosome2
Chromosomal Location39016155-39065541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39047648 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 128 (N128S)
Ref Sequence ENSEMBL: ENSMUSP00000145206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000149810] [ENSMUST00000184996]
Predicted Effect probably benign
Transcript: ENSMUST00000039165
AA Change: N227S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: N227S

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112850
AA Change: N202S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: N202S

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136261
Predicted Effect probably benign
Transcript: ENSMUST00000149810
AA Change: N128S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145206
Gene: ENSMUSG00000026754
AA Change: N128S

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
coiled coil region 70 183 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153914
AA Change: N144S
Predicted Effect probably benign
Transcript: ENSMUST00000184996
AA Change: N227S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: N227S

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cckar A T 5: 53,706,453 S55R probably damaging Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dlk2 C A 17: 46,302,604 R262S possibly damaging Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Galnt14 T C 17: 73,522,720 T277A probably damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Hist1h1t T C 13: 23,695,903 V13A probably benign Het
Ift22 T C 5: 136,911,891 C137R probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Olfr611 A T 7: 103,517,501 Y294* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Uhrf1bp1 C T 17: 27,880,202 T246M possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 39052973 nonsense probably null
IGL00949:Golga1 APN 2 39041255 missense probably damaging 0.98
IGL01133:Golga1 APN 2 39023472 missense probably benign
IGL01592:Golga1 APN 2 39063282 missense probably damaging 1.00
IGL01613:Golga1 APN 2 39020126 missense probably benign 0.14
IGL01819:Golga1 APN 2 39034149 missense probably benign 0.00
IGL01871:Golga1 APN 2 39050198 splice site probably benign
IGL02744:Golga1 APN 2 39018474 missense probably damaging 1.00
IGL02819:Golga1 APN 2 39039078 missense probably null 0.97
IGL02874:Golga1 APN 2 39039092 missense probably damaging 1.00
R0245:Golga1 UTSW 2 39035259 missense probably benign 0.00
R0389:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0443:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0906:Golga1 UTSW 2 39047643 missense probably damaging 0.99
R1508:Golga1 UTSW 2 39023249 missense probably benign
R1901:Golga1 UTSW 2 39047780 splice site probably null
R1964:Golga1 UTSW 2 39047087 missense probably benign 0.00
R2228:Golga1 UTSW 2 39023171 missense probably benign 0.02
R3734:Golga1 UTSW 2 39050170 missense possibly damaging 0.88
R4407:Golga1 UTSW 2 39019641 unclassified probably null
R4504:Golga1 UTSW 2 39023454 missense probably benign 0.00
R4973:Golga1 UTSW 2 39039106 missense probably damaging 0.99
R5049:Golga1 UTSW 2 39047735 missense probably damaging 1.00
R5600:Golga1 UTSW 2 39020099 missense probably damaging 1.00
R6008:Golga1 UTSW 2 39047087 missense probably benign 0.00
R6374:Golga1 UTSW 2 39034068 missense probably benign
R6388:Golga1 UTSW 2 39023171 missense probably benign 0.02
R6601:Golga1 UTSW 2 39020106 missense probably damaging 1.00
R7067:Golga1 UTSW 2 39047719 missense probably benign 0.00
X0025:Golga1 UTSW 2 39052062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCTTTGCCAGCACTGAG -3'
(R):5'- AGTACCAATGAGCAGTGAGCCTTTATG -3'

Sequencing Primer
(F):5'- CCAGCACTGAGATAAAAAGGTTCTG -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On2013-04-16