Incidental Mutation 'R0167:Cckar'
ID24219
Institutional Source Beutler Lab
Gene Symbol Cckar
Ensembl Gene ENSMUSG00000029193
Gene Namecholecystokinin A receptor
Synonyms
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0167 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53697776-53707705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53706453 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 55 (S55R)
Ref Sequence ENSEMBL: ENSMUSP00000031093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031093] [ENSMUST00000200691]
Predicted Effect probably damaging
Transcript: ENSMUST00000031093
AA Change: S55R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031093
Gene: ENSMUSG00000029193
AA Change: S55R

DomainStartEndE-ValueType
Pfam:CholecysA-Rec_N 1 47 8.8e-29 PFAM
Pfam:7tm_4 48 252 7.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 52 393 2.6e-10 PFAM
Pfam:7tm_1 58 378 1.1e-66 PFAM
low complexity region 399 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200691
SMART Domains Protein: ENSMUSP00000144103
Gene: ENSMUSG00000029193

DomainStartEndE-ValueType
Pfam:7tm_1 1 307 1.6e-59 PFAM
Pfam:7tm_4 3 181 1.8e-6 PFAM
low complexity region 328 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202946
Meta Mutation Damage Score 0.0436 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor that binds non-sulfated members of the cholecystokinin (CCK) family of peptide hormones. This receptor is a major physiologic mediator of pancreatic enzyme secretion and smooth muscle contraction of the gallbladder and stomach. In the central and peripheral nervous system this receptor regulates satiety and the release of beta-endorphin and dopamine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice cannot regulate core body temperature in response to changes in ambient temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dlk2 C A 17: 46,302,604 R262S possibly damaging Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Galnt14 T C 17: 73,522,720 T277A probably damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Golga1 T C 2: 39,047,648 N128S probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Hist1h1t T C 13: 23,695,903 V13A probably benign Het
Ift22 T C 5: 136,911,891 C137R probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Olfr611 A T 7: 103,517,501 Y294* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Uhrf1bp1 C T 17: 27,880,202 T246M possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Cckar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cckar APN 5 53699829 missense possibly damaging 0.86
IGL00568:Cckar APN 5 53707301 missense probably benign 0.02
IGL00766:Cckar APN 5 53700036 missense probably damaging 0.99
IGL00960:Cckar APN 5 53701292 missense probably damaging 1.00
IGL02424:Cckar APN 5 53706428 missense possibly damaging 0.63
IGL03002:Cckar APN 5 53702905 missense probably damaging 0.99
R0302:Cckar UTSW 5 53700299 frame shift probably null
R0366:Cckar UTSW 5 53700165 missense probably benign 0.01
R0391:Cckar UTSW 5 53706253 critical splice donor site probably null
R0981:Cckar UTSW 5 53706290 missense probably damaging 1.00
R1619:Cckar UTSW 5 53700067 missense probably damaging 1.00
R1644:Cckar UTSW 5 53699873 missense probably benign
R1779:Cckar UTSW 5 53699979 missense probably damaging 1.00
R2184:Cckar UTSW 5 53702912 missense probably damaging 0.96
R4290:Cckar UTSW 5 53706497 missense probably benign
R4291:Cckar UTSW 5 53706497 missense probably benign
R4292:Cckar UTSW 5 53706497 missense probably benign
R4294:Cckar UTSW 5 53706497 missense probably benign
R4518:Cckar UTSW 5 53699922 missense probably damaging 1.00
R4583:Cckar UTSW 5 53699782 missense probably benign 0.01
R5139:Cckar UTSW 5 53702923 missense probably benign 0.00
R5505:Cckar UTSW 5 53703068 missense probably damaging 1.00
R6207:Cckar UTSW 5 53699844 missense probably benign
R6415:Cckar UTSW 5 53703056 missense probably damaging 1.00
R7127:Cckar UTSW 5 53706475 missense probably damaging 1.00
X0028:Cckar UTSW 5 53707273 missense probably benign 0.22
X0028:Cckar UTSW 5 53707274 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTAGGTGGTAGTCTTGCACACGG -3'
(R):5'- AAAGCCAGGAGCCTTCAGAAGC -3'

Sequencing Primer
(F):5'- GCACTTCCGAAGATGAAATCCTTG -3'
(R):5'- CTGGAAAAACTGCTTTCCTGACG -3'
Posted On2013-04-16