Incidental Mutation 'R0167:Ift22'
ID24221
Institutional Source Beutler Lab
Gene Symbol Ift22
Ensembl Gene ENSMUSG00000007987
Gene Nameintraflagellar transport 22
Synonyms3110017O03Rik, Rabl5
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0167 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location136908150-136915404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136911891 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 137 (C137R)
Ref Sequence ENSEMBL: ENSMUSP00000142389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000199101] [ENSMUST00000200153] [ENSMUST00000200157]
Predicted Effect silent
Transcript: ENSMUST00000008131
SMART Domains Protein: ENSMUSP00000008131
Gene: ENSMUSG00000007987

DomainStartEndE-ValueType
Pfam:Arf 2 129 6.2e-10 PFAM
Pfam:SRPRB 2 182 9.9e-8 PFAM
Pfam:Ras 5 125 2.1e-13 PFAM
Pfam:Roc 5 125 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199101
AA Change: S107P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143017
Gene: ENSMUSG00000007987
AA Change: S107P

DomainStartEndE-ValueType
SCOP:d1f6ba_ 5 91 2e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200054
Predicted Effect probably benign
Transcript: ENSMUST00000200153
AA Change: C137R

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142389
Gene: ENSMUSG00000007987
AA Change: C137R

DomainStartEndE-ValueType
Pfam:Arf 2 133 1.1e-8 PFAM
Pfam:SRPRB 2 133 1.5e-5 PFAM
Pfam:Miro 5 122 7.9e-7 PFAM
Pfam:Ras 5 125 3.1e-12 PFAM
low complexity region 148 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200157
AA Change: S137P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143488
Gene: ENSMUSG00000007987
AA Change: S137P

DomainStartEndE-ValueType
Pfam:Arf 2 129 6.4e-10 PFAM
Pfam:SRPRB 2 181 1e-7 PFAM
Pfam:Miro 5 122 5.1e-8 PFAM
Pfam:Ras 5 125 1.9e-13 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cckar A T 5: 53,706,453 S55R probably damaging Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dlk2 C A 17: 46,302,604 R262S possibly damaging Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Galnt14 T C 17: 73,522,720 T277A probably damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Golga1 T C 2: 39,047,648 N128S probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Hist1h1t T C 13: 23,695,903 V13A probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Olfr611 A T 7: 103,517,501 Y294* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Uhrf1bp1 C T 17: 27,880,202 T246M possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Ift22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02153:Ift22 APN 5 136911696 missense probably benign 0.44
IGL02755:Ift22 APN 5 136911786 missense probably damaging 1.00
R0556:Ift22 UTSW 5 136911291 splice site probably null
R1378:Ift22 UTSW 5 136912903 missense probably benign 0.09
R2927:Ift22 UTSW 5 136912945 missense probably damaging 1.00
R4058:Ift22 UTSW 5 136911863 missense unknown
R4562:Ift22 UTSW 5 136912870 missense probably benign 0.32
R4650:Ift22 UTSW 5 136911801 missense probably benign 0.40
R4957:Ift22 UTSW 5 136908216 start gained probably benign
R6057:Ift22 UTSW 5 136911133 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTCTGCTTCTACAGGTGAGTGAC -3'
(R):5'- GCCAAGGTGAATGGCTTTCCTGAG -3'

Sequencing Primer
(F):5'- gggggtgtggctcagtg -3'
(R):5'- gaatggctttcctgagaatgac -3'
Posted On2013-04-16