Incidental Mutation 'R2268:Mink1'
ID242247
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission 040268-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R2268 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 70601724 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
Predicted Effect probably null
Transcript: ENSMUST00000072237
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072873
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079244
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102558
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102559
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133310
Predicted Effect probably benign
Transcript: ENSMUST00000136663
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153503
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Meta Mutation Damage Score 0.6212 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Acox2 A T 14: 8,253,496 M217K probably damaging Het
Adam34 C T 8: 43,650,610 R666H probably benign Het
Adap2 G T 11: 80,165,726 Q188H probably damaging Het
Adgrb3 T C 1: 25,111,817 T872A possibly damaging Het
Ahnak A G 19: 9,010,574 K3074R possibly damaging Het
Ano7 A T 1: 93,380,439 D64V possibly damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Arl13a A G X: 134,205,413 Q236R possibly damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Atn1 C G 6: 124,746,240 probably benign Het
Ccser1 C T 6: 61,570,843 T118M probably damaging Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Col17a1 G A 19: 47,650,111 P1173S probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp4f17 G T 17: 32,517,954 V87F probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dhodh A G 8: 109,594,674 F360S possibly damaging Het
Dynap C T 18: 70,241,147 A103T probably benign Het
Edem2 G A 2: 155,702,217 P538S probably benign Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Erich6 A T 3: 58,618,839 S581T probably benign Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Fzd9 A G 5: 135,250,294 S246P probably damaging Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hmcn1 A G 1: 150,624,598 probably benign Het
Hps3 G A 3: 20,012,935 probably benign Het
Hr A T 14: 70,558,107 D393V probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Irs2 T C 8: 11,007,586 E282G probably damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kif14 T A 1: 136,519,748 C1430* probably null Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lamb1 A T 12: 31,327,645 I1630F probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtbp G A 15: 55,569,160 probably null Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Myoc C T 1: 162,649,056 T443M probably damaging Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr906 T A 9: 38,488,208 Y60N probably damaging Het
Opcml T C 9: 28,903,355 I301T possibly damaging Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rdh7 A G 10: 127,884,661 S281P probably benign Het
Rps17 C T 7: 81,344,998 R5H probably benign Het
Scgb1b2 T A 7: 31,291,776 probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Snap23 A G 2: 120,599,312 T213A probably benign Het
Spag17 C A 3: 100,061,866 probably null Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
St8sia5 T C 18: 77,232,830 S93P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbc1d22b A G 17: 29,599,854 H394R probably damaging Het
Tbx5 A T 5: 119,845,109 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Ttc37 T G 13: 76,112,274 probably benign Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Vangl1 A T 3: 102,196,844 Y7N probably damaging Het
Vav2 A T 2: 27,292,655 probably null Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r15 A G 5: 109,293,207 Y262H probably benign Het
Vmn2r76 T C 7: 86,230,499 M198V probably benign Het
Zfp831 A C 2: 174,644,241 R236S probably benign Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACTCACACCAGTCTGG -3'
(R):5'- AGGGGAGGTTAGCTCTTAGTCC -3'

Sequencing Primer
(F):5'- CTGGTCTTGCTCCAGGAGTC -3'
(R):5'- GCTCTTAGTCCATTCAGAGTGAAGC -3'
Posted On2014-10-16