Incidental Mutation 'R2268:Hr'
ID242260
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Namehairless
SynonymsALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
MMRRC Submission 040268-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2268 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70552212-70573548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70558107 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 393 (D393V)
Ref Sequence ENSEMBL: ENSMUSP00000124042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
Predicted Effect probably benign
Transcript: ENSMUST00000022691
AA Change: D364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: D364V

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159959
Predicted Effect probably benign
Transcript: ENSMUST00000161069
AA Change: D364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: D364V

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161468
Predicted Effect probably benign
Transcript: ENSMUST00000163060
AA Change: D393V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: D393V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Meta Mutation Damage Score 0.0452 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
Acox2 A T 14: 8,253,496 M217K probably damaging Het
Adam34 C T 8: 43,650,610 R666H probably benign Het
Adap2 G T 11: 80,165,726 Q188H probably damaging Het
Adgrb3 T C 1: 25,111,817 T872A possibly damaging Het
Ahnak A G 19: 9,010,574 K3074R possibly damaging Het
Ano7 A T 1: 93,380,439 D64V possibly damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Arl13a A G X: 134,205,413 Q236R possibly damaging Het
Astn1 T C 1: 158,502,099 Y175H probably damaging Het
Atn1 C G 6: 124,746,240 probably benign Het
Ccser1 C T 6: 61,570,843 T118M probably damaging Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Col17a1 G A 19: 47,650,111 P1173S probably benign Het
Commd8 A G 5: 72,165,422 W51R probably damaging Het
Cyp4f17 G T 17: 32,517,954 V87F probably benign Het
D2hgdh C T 1: 93,835,435 A314V probably damaging Het
Dcun1d4 T A 5: 73,481,275 probably benign Het
Dhodh A G 8: 109,594,674 F360S possibly damaging Het
Dynap C T 18: 70,241,147 A103T probably benign Het
Edem2 G A 2: 155,702,217 P538S probably benign Het
Egfl8 C T 17: 34,613,858 V253M probably damaging Het
Erich6 A T 3: 58,618,839 S581T probably benign Het
Fam117b T C 1: 59,913,630 L156P probably damaging Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Foxn4 T C 5: 114,255,601 T486A probably damaging Het
Fzd9 A G 5: 135,250,294 S246P probably damaging Het
Hdhd2 C T 18: 76,965,170 T172M probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hmcn1 A G 1: 150,624,598 probably benign Het
Hps3 G A 3: 20,012,935 probably benign Het
Ido2 T C 8: 24,535,252 Y253C probably damaging Het
Irs2 T C 8: 11,007,586 E282G probably damaging Het
Itih4 A G 14: 30,892,428 D445G probably damaging Het
Kif14 T A 1: 136,519,748 C1430* probably null Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lamb1 A T 12: 31,327,645 I1630F probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Magi3 G A 3: 104,021,066 probably benign Het
Mink1 G A 11: 70,601,724 probably null Het
Mmrn2 A G 14: 34,399,492 K773R probably benign Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mtbp G A 15: 55,569,160 probably null Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Myoc C T 1: 162,649,056 T443M probably damaging Het
Nav1 A T 1: 135,472,236 L532* probably null Het
Nbeal1 T A 1: 60,330,878 probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr906 T A 9: 38,488,208 Y60N probably damaging Het
Opcml T C 9: 28,903,355 I301T possibly damaging Het
Pappa2 A G 1: 158,857,271 M766T probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Phka1 A G X: 102,541,110 probably benign Het
Ppp2ca G A 11: 52,118,086 G138R probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rdh7 A G 10: 127,884,661 S281P probably benign Het
Rps17 C T 7: 81,344,998 R5H probably benign Het
Scgb1b2 T A 7: 31,291,776 probably benign Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Snap23 A G 2: 120,599,312 T213A probably benign Het
Spag17 C A 3: 100,061,866 probably null Het
Srebf1 A G 11: 60,207,147 S44P probably damaging Het
St8sia5 T C 18: 77,232,830 S93P probably damaging Het
Styk1 T C 6: 131,312,576 E25G probably benign Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tbc1d14 A G 5: 36,543,217 L269P possibly damaging Het
Tbc1d22b A G 17: 29,599,854 H394R probably damaging Het
Tbx5 A T 5: 119,845,109 probably null Het
Tgfbr3l A G 8: 4,250,506 E228G probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Tmem233 G C 5: 116,051,458 probably benign Het
Ttc37 T G 13: 76,112,274 probably benign Het
Tymp A T 15: 89,373,808 V378D probably damaging Het
Vangl1 A T 3: 102,196,844 Y7N probably damaging Het
Vav2 A T 2: 27,292,655 probably null Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r15 A G 5: 109,293,207 Y262H probably benign Het
Vmn2r76 T C 7: 86,230,499 M198V probably benign Het
Zfp831 A C 2: 174,644,241 R236S probably benign Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site probably benign
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
subclinical UTSW 14 70561836 missense possibly damaging 0.89
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
R7030:Hr UTSW 14 70563684 critical splice donor site probably null
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGGTTCACAGTCTTGGCAAC -3'
(R):5'- TGATGCTCCTTGGACCTCTG -3'

Sequencing Primer
(F):5'- CCAGGAAGTAATAGCCTTGGGTAC -3'
(R):5'- TTGGACCTCTGGACTGCCTG -3'
Posted On2014-10-16