Incidental Mutation 'R2270:Nfix'
ID242394
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
MMRRC Submission 040270-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R2270 (G1)
Quality Score110
Status Not validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAAAA to CAAAA at 84716247 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect probably benign
Transcript: ENSMUST00000076715
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099070
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109762
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109764
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126806
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132236
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,077,431 R54W possibly damaging Het
Adam22 T C 5: 8,121,108 E614G probably damaging Het
Ap4e1 T C 2: 127,047,163 probably null Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atp11b A G 3: 35,810,134 probably null Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Chat T C 14: 32,454,581 R79G probably damaging Het
Chek1 A G 9: 36,719,686 L144P probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Crip2 A C 12: 113,144,866 K62N probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnm3 A T 1: 162,477,789 L12Q probably damaging Het
Eftud2 T C 11: 102,864,781 N200S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgfbp1 T A 5: 43,979,330 M207L probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Garem2 T G 5: 30,116,974 L777R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpr143 T A X: 152,790,570 V181E probably damaging Het
Gtf2f1 T C 17: 57,003,462 I498V probably null Het
Ipo4 A G 14: 55,634,100 L168P probably damaging Het
Ism1 T A 2: 139,757,373 I415N probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mre11a A G 9: 14,815,174 E411G probably benign Het
Mybpc1 C A 10: 88,551,407 V106F probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
N4bp3 A T 11: 51,644,305 N352K probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ncor2 A G 5: 125,037,955 V515A probably benign Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Olfm4 C A 14: 80,011,875 T144K probably damaging Het
Olfr741 G T 14: 50,486,037 C193F probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Phf12 G T 11: 77,984,175 A76S possibly damaging Het
Plb1 G T 5: 32,293,242 D376Y probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prkg1 A G 19: 30,578,631 V610A probably benign Het
Prrc2a T C 17: 35,149,536 T2104A possibly damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Ranbp2 T C 10: 58,455,927 V252A probably benign Het
Rcn3 A G 7: 45,088,651 S98P probably damaging Het
Rere T C 4: 150,477,380 S248P unknown Het
Rnaseh2a T C 8: 84,965,419 E75G probably benign Het
Slc15a1 A T 14: 121,479,994 M292K probably damaging Het
Slc1a2 T G 2: 102,735,994 L14R probably damaging Het
Slfn2 C T 11: 83,069,935 R247C probably damaging Het
Ttn T C 2: 76,948,364 I1218M probably damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Yme1l1 T C 2: 23,175,220 I247T possibly damaging Het
Zc3h13 T C 14: 75,332,147 M1478T probably benign Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Znhit2 A G 19: 6,061,231 E2G probably damaging Het
Zpbp A T 11: 11,418,272 M133K probably benign Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0600:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0628:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0882:Nfix UTSW 8 84727925 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3727:Nfix UTSW 8 84716247 frame shift probably null
R3791:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5013:Nfix UTSW 8 84772084 missense possibly damaging 0.86
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
R6786:Nfix UTSW 8 84727647 missense probably damaging 1.00
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCTGGCTGGAGTAACTGAG -3'
(R):5'- TGTGCCTAGAGGAAAGGACC -3'

Sequencing Primer
(F):5'- CCTCTCTTTGCAGTGGAGAC -3'
(R):5'- GAGGAAAGGACCCTCCCTC -3'
Posted On2014-10-16