Incidental Mutation 'R0167:Dlk2'
ID24244
Institutional Source Beutler Lab
Gene Symbol Dlk2
Ensembl Gene ENSMUSG00000047428
Gene Namedelta like non-canonical Notch ligand 2
SynonymsEgfl9
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R0167 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location46297421-46303271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46302604 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 262 (R262S)
Ref Sequence ENSEMBL: ENSMUSP00000058470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000061722] [ENSMUST00000095261] [ENSMUST00000166280] [ENSMUST00000166617] [ENSMUST00000167360] [ENSMUST00000170271] [ENSMUST00000171584] [ENSMUST00000188223]
Predicted Effect probably benign
Transcript: ENSMUST00000047970
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061722
AA Change: R262S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058470
Gene: ENSMUSG00000047428
AA Change: R262S

DomainStartEndE-ValueType
EGF_like 71 101 3.16e1 SMART
EGF 102 132 7.76e-3 SMART
EGF 137 172 2.14e-5 SMART
EGF 177 215 3.79e-6 SMART
EGF_CA 217 253 3.1e-11 SMART
EGF_CA 255 291 9.47e-7 SMART
transmembrane domain 349 371 N/A INTRINSIC
low complexity region 383 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095261
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166280
AA Change: R219S

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126993
Gene: ENSMUSG00000047428
AA Change: R219S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166617
AA Change: R219S

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128897
Gene: ENSMUSG00000047428
AA Change: R219S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167360
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170271
SMART Domains Protein: ENSMUSP00000132349
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188223
SMART Domains Protein: ENSMUSP00000141164
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
Pfam:hEGF 88 100 7.9e-4 PFAM
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cckar A T 5: 53,706,453 S55R probably damaging Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Galnt14 T C 17: 73,522,720 T277A probably damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Golga1 T C 2: 39,047,648 N128S probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Hist1h1t T C 13: 23,695,903 V13A probably benign Het
Ift22 T C 5: 136,911,891 C137R probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Olfr611 A T 7: 103,517,501 Y294* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Uhrf1bp1 C T 17: 27,880,202 T246M possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Dlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Dlk2 APN 17 46302464 missense probably damaging 1.00
IGL03242:Dlk2 APN 17 46302977 missense probably benign 0.00
R0133:Dlk2 UTSW 17 46298942 splice site probably benign
R0462:Dlk2 UTSW 17 46303098 makesense probably null
R4809:Dlk2 UTSW 17 46299014 splice site probably null
R6109:Dlk2 UTSW 17 46301697 missense probably damaging 1.00
R6520:Dlk2 UTSW 17 46302512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTGAGGTCAATGTGGACGAC -3'
(R):5'- GGCAACCAGGCTAGATTCACCAAG -3'

Sequencing Primer
(F):5'- ACGACTGTCTGATGCGG -3'
(R):5'- TCACTGAGATCCTTAGCAGGC -3'
Posted On2013-04-16