Incidental Mutation 'R2272:Matn4'
ID242536
Institutional Source Beutler Lab
Gene Symbol Matn4
Ensembl Gene ENSMUSG00000016995
Gene Namematrilin 4
Synonymsmatrilin-4
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164389393-164405160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164397242 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 232 (C232S)
Ref Sequence ENSEMBL: ENSMUSP00000104983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103103] [ENSMUST00000103104] [ENSMUST00000109358] [ENSMUST00000109359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103103
AA Change: C273S

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099392
Gene: ENSMUSG00000016995
AA Change: C273S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103104
AA Change: C273S

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099393
Gene: ENSMUSG00000016995
AA Change: C273S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109358
SMART Domains Protein: ENSMUSP00000104982
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.85e0 SMART
EGF 261 298 1.24e-1 SMART
VWA 304 482 6.72e-56 SMART
Matrilin_ccoil 492 539 2.39e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109359
AA Change: C232S

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104983
Gene: ENSMUSG00000016995
AA Change: C232S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 3.43e-4 SMART
EGF 261 298 1.85e0 SMART
EGF 302 339 1.24e-1 SMART
VWA 345 523 6.72e-56 SMART
Matrilin_ccoil 533 580 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154940
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Matn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Matn4 APN 2 164400743 missense probably damaging 0.97
IGL02188:Matn4 APN 2 164400866 missense probably benign 0.00
IGL02195:Matn4 APN 2 164401052 missense probably damaging 1.00
IGL02696:Matn4 APN 2 164396838 missense probably benign 0.09
IGL02927:Matn4 APN 2 164389837 missense probably damaging 1.00
R2021:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2022:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2448:Matn4 UTSW 2 164401850 missense probably benign 0.04
R4824:Matn4 UTSW 2 164393231 missense probably benign 0.01
R4839:Matn4 UTSW 2 164400976 missense probably benign 0.00
R5884:Matn4 UTSW 2 164404608 utr 5 prime probably benign
R5914:Matn4 UTSW 2 164393224 missense probably damaging 1.00
R6209:Matn4 UTSW 2 164400815 missense probably damaging 1.00
R6995:Matn4 UTSW 2 164389664 nonsense probably null
X0063:Matn4 UTSW 2 164397277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGTAGTCAATGGCTGAGG -3'
(R):5'- ACAAGGGTTGTGTGGCTTCC -3'

Sequencing Primer
(F):5'- CAGTAGTCAATGGCTGAGGGAAGG -3'
(R):5'- CTTCCGAGGGTTGCTTGGC -3'
Posted On2014-10-16