Incidental Mutation 'R2272:Cyfip1'
ID242564
Institutional Source Beutler Lab
Gene Symbol Cyfip1
Ensembl Gene ENSMUSG00000030447
Gene Namecytoplasmic FMR1 interacting protein 1
Synonymsl(7)1Rl, pl-1, P140SRA-1, l7Rl1, Sra-1, Shyc, E030028J09Rik
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location55841745-55932602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55899957 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 624 (R624L)
Ref Sequence ENSEMBL: ENSMUSP00000127717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000085255] [ENSMUST00000163845] [ENSMUST00000206862]
Predicted Effect probably null
Transcript: ENSMUST00000032629
AA Change: R624L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447
AA Change: R624L

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085255
AA Change: R622L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447
AA Change: R622L

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1222 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163845
AA Change: R624L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447
AA Change: R624L

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1224 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174660
Predicted Effect probably null
Transcript: ENSMUST00000206862
AA Change: R594L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations at this locus result in embryonic lethality before the turning stage in homozygotes. Heterozygotes exhibit abnormal synaptic transmission. Parental origin of the mutant allele in heterozygotes has an effect on long term depression, cued fear conditioning, anxiety, and activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Cyfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cyfip1 APN 7 55904210 missense probably damaging 1.00
IGL01351:Cyfip1 APN 7 55898243 nonsense probably null
IGL01662:Cyfip1 APN 7 55896739 missense probably damaging 1.00
IGL02034:Cyfip1 APN 7 55898353 missense probably damaging 0.99
IGL02039:Cyfip1 APN 7 55875021 missense possibly damaging 0.90
IGL02063:Cyfip1 APN 7 55926348 missense probably damaging 1.00
IGL02429:Cyfip1 APN 7 55871982 splice site probably benign
IGL03256:Cyfip1 APN 7 55907434 missense possibly damaging 0.67
R0455:Cyfip1 UTSW 7 55892054 missense probably benign 0.18
R0546:Cyfip1 UTSW 7 55922816 nonsense probably null
R0671:Cyfip1 UTSW 7 55923962 unclassified probably null
R0732:Cyfip1 UTSW 7 55886781 missense probably damaging 1.00
R0843:Cyfip1 UTSW 7 55922820 missense probably benign 0.24
R1666:Cyfip1 UTSW 7 55871898 missense probably damaging 0.99
R1789:Cyfip1 UTSW 7 55926395 missense probably damaging 1.00
R1817:Cyfip1 UTSW 7 55873448 missense possibly damaging 0.51
R1929:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2271:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2328:Cyfip1 UTSW 7 55894991 missense possibly damaging 0.87
R2518:Cyfip1 UTSW 7 55928284 missense probably damaging 1.00
R2963:Cyfip1 UTSW 7 55895035 missense probably damaging 0.99
R4271:Cyfip1 UTSW 7 55879101 missense probably benign 0.02
R4435:Cyfip1 UTSW 7 55900041 missense probably damaging 0.99
R4640:Cyfip1 UTSW 7 55913451 missense possibly damaging 0.92
R4676:Cyfip1 UTSW 7 55875013 missense probably damaging 0.99
R4887:Cyfip1 UTSW 7 55872068 missense probably damaging 1.00
R5085:Cyfip1 UTSW 7 55898335 missense probably benign 0.33
R5238:Cyfip1 UTSW 7 55892031 missense probably benign
R5244:Cyfip1 UTSW 7 55925199 missense probably damaging 1.00
R5288:Cyfip1 UTSW 7 55925135 missense possibly damaging 0.60
R5294:Cyfip1 UTSW 7 55873483 missense possibly damaging 0.88
R5552:Cyfip1 UTSW 7 55872107 missense possibly damaging 0.94
R5558:Cyfip1 UTSW 7 55892001 missense possibly damaging 0.71
R5667:Cyfip1 UTSW 7 55873730 missense probably benign 0.19
R5819:Cyfip1 UTSW 7 55879151 missense probably damaging 1.00
R5859:Cyfip1 UTSW 7 55925181 missense probably damaging 1.00
R5867:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5868:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5944:Cyfip1 UTSW 7 55872130 missense probably damaging 0.98
R6124:Cyfip1 UTSW 7 55897943 missense probably benign 0.12
R6131:Cyfip1 UTSW 7 55873480 missense possibly damaging 0.79
R6219:Cyfip1 UTSW 7 55908441 missense possibly damaging 0.52
R6243:Cyfip1 UTSW 7 55900529 missense probably damaging 1.00
R6669:Cyfip1 UTSW 7 55900061 missense probably damaging 0.99
R6869:Cyfip1 UTSW 7 55907365 missense possibly damaging 0.73
R7014:Cyfip1 UTSW 7 55919493 missense probably benign 0.34
R7224:Cyfip1 UTSW 7 55928189 frame shift probably null
R7225:Cyfip1 UTSW 7 55928189 frame shift probably null
R7305:Cyfip1 UTSW 7 55928189 frame shift probably null
R7336:Cyfip1 UTSW 7 55926400 missense possibly damaging 0.96
X0018:Cyfip1 UTSW 7 55900025 missense probably damaging 0.98
X0028:Cyfip1 UTSW 7 55907430 missense probably damaging 1.00
Z1088:Cyfip1 UTSW 7 55875052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCATACCCGTGTTCGTCTTG -3'
(R):5'- ATGAATGTGTGAAGGTACATGC -3'

Sequencing Primer
(F):5'- CTCATGTGAAGTGTCCAGTGACC -3'
(R):5'- CATGTGTGCCAAGGCCTCAG -3'
Posted On2014-10-16