Incidental Mutation 'R2272:Ddc'
ID242580
Institutional Source Beutler Lab
Gene Symbol Ddc
Ensembl Gene ENSMUSG00000020182
Gene Namedopa decarboxylase
SynonymsAadc, aromatic L-amino acid decarboxylase
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location11814101-11898144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11835764 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 308 (N308D)
Ref Sequence ENSEMBL: ENSMUSP00000136467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066237] [ENSMUST00000109659] [ENSMUST00000178704]
Predicted Effect probably damaging
Transcript: ENSMUST00000066237
AA Change: N308D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182
AA Change: N308D

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109659
AA Change: N308D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182
AA Change: N308D

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134401
Predicted Effect probably damaging
Transcript: ENSMUST00000178704
AA Change: N308D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182
AA Change: N308D

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit preweaning phenotype. Mice homozygous for a different knock-in allele exhibit partial prenatal lethality, decreased body size, postnatal growth retardation, hypoactivity, increased anxiety, tremors, decreased heart rate and decreased dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Ddc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Ddc APN 11 11839462 missense probably damaging 1.00
IGL01336:Ddc APN 11 11846630 splice site probably null
IGL02257:Ddc APN 11 11873171 nonsense probably null
IGL02327:Ddc APN 11 11863739 missense probably damaging 0.98
IGL02516:Ddc APN 11 11829125 missense probably damaging 1.00
IGL02616:Ddc APN 11 11880645 utr 5 prime probably benign
IGL02888:Ddc APN 11 11822297 splice site probably benign
IGL03267:Ddc APN 11 11876303 missense probably damaging 1.00
R0454:Ddc UTSW 11 11880587 missense possibly damaging 0.88
R1061:Ddc UTSW 11 11829132 missense probably benign 0.00
R1173:Ddc UTSW 11 11846634 critical splice donor site probably null
R1382:Ddc UTSW 11 11824856 missense possibly damaging 0.52
R1549:Ddc UTSW 11 11846656 unclassified probably null
R1583:Ddc UTSW 11 11829131 missense probably benign 0.17
R1929:Ddc UTSW 11 11835764 missense probably damaging 1.00
R1970:Ddc UTSW 11 11815292 missense possibly damaging 0.87
R2034:Ddc UTSW 11 11880456 missense probably benign 0.40
R2270:Ddc UTSW 11 11835764 missense probably damaging 1.00
R4449:Ddc UTSW 11 11835802 missense probably damaging 1.00
R4508:Ddc UTSW 11 11819393 critical splice acceptor site probably null
R4799:Ddc UTSW 11 11846632 splice site probably null
R5307:Ddc UTSW 11 11876321 missense probably damaging 1.00
R6654:Ddc UTSW 11 11880452 missense probably damaging 1.00
R6817:Ddc UTSW 11 11824854 missense probably damaging 1.00
R6918:Ddc UTSW 11 11819307 missense probably damaging 1.00
R7001:Ddc UTSW 11 11824870 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTTGAGCAAGAATTCCAGC -3'
(R):5'- TCACGTGAGGAATCTTGCG -3'

Sequencing Primer
(F):5'- TTCCAGCAGCACTCTGAAATGG -3'
(R):5'- TGATCTTAGAGCCTGGGACCTAAAAC -3'
Posted On2014-10-16