Incidental Mutation 'R2272:Wnt10b'
ID242596
Institutional Source Beutler Lab
Gene Symbol Wnt10b
Ensembl Gene ENSMUSG00000022996
Gene Namewingless-type MMTV integration site family, member 10B
SynonymsWnt12
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98770712-98778150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98774347 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 163 (Q163L)
Ref Sequence ENSEMBL: ENSMUSP00000153930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023732] [ENSMUST00000166022] [ENSMUST00000226610] [ENSMUST00000226655] [ENSMUST00000226846] [ENSMUST00000228546] [ENSMUST00000228594]
Predicted Effect probably damaging
Transcript: ENSMUST00000023732
AA Change: Q163L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023732
Gene: ENSMUSG00000022996
AA Change: Q163L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
WNT1 50 389 9.1e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166022
AA Change: Q163L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131056
Gene: ENSMUSG00000022996
AA Change: Q163L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
WNT1 50 389 9.1e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226610
AA Change: Q163L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000226655
Predicted Effect probably benign
Transcript: ENSMUST00000226846
Predicted Effect probably benign
Transcript: ENSMUST00000228546
Predicted Effect probably damaging
Transcript: ENSMUST00000228594
AA Change: Q163L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It may be involved in breast cancer, and its protein signaling is likely a molecular switch that governs adipogenesis. This protein is 96% identical to the mouse Wnt10b protein at the amino acid level. This gene is clustered with another family member, WNT1, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice fed a low- or high-fat diet exhibit accelerated myogenic differentiation of myoblasts and those fed a high-fat diet exhibit excessive lipid accumulation in actively regenerating muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Other mutations in Wnt10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Wnt10b APN 15 98776945 utr 5 prime probably benign
R0555:Wnt10b UTSW 15 98772937 splice site probably benign
R1747:Wnt10b UTSW 15 98774333 missense probably benign 0.00
R1751:Wnt10b UTSW 15 98772675 missense probably damaging 0.99
R1767:Wnt10b UTSW 15 98772675 missense probably damaging 0.99
R2282:Wnt10b UTSW 15 98774221 missense probably damaging 0.99
R3911:Wnt10b UTSW 15 98774338 missense possibly damaging 0.53
R4997:Wnt10b UTSW 15 98774203 missense probably damaging 0.99
R5226:Wnt10b UTSW 15 98776614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGGATCCGCATTCTCGC -3'
(R):5'- TGACATTGGCTGCTGCTAC -3'

Sequencing Primer
(F):5'- CGCATTCTCGCCTGGATG -3'
(R):5'- GTTCACACCTATGCGCTTAGGAAG -3'
Posted On2014-10-16