Incidental Mutation 'R0172:Hip1r'
ID24269
Institutional Source Beutler Lab
Gene Symbol Hip1r
Ensembl Gene ENSMUSG00000000915
Gene Namehuntingtin interacting protein 1 related
Synonyms
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0172 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123973628-124005558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123996940 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 380 (Y380N)
Ref Sequence ENSEMBL: ENSMUSP00000000939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000939
AA Change: Y380N

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000939
Gene: ENSMUSG00000000915
AA Change: Y380N

DomainStartEndE-ValueType
ENTH 29 151 5.27e-40 SMART
low complexity region 301 321 N/A INTRINSIC
PDB:3I00|B 340 458 1e-21 PDB
Pfam:HIP1_clath_bdg 461 559 1.1e-34 PFAM
low complexity region 627 633 N/A INTRINSIC
ILWEQ 814 1012 9.19e-121 SMART
low complexity region 1016 1035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166258
SMART Domains Protein: ENSMUSP00000130766
Gene: ENSMUSG00000000915

DomainStartEndE-ValueType
Pfam:ANTH 1 79 3.5e-19 PFAM
low complexity region 80 100 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185154
Predicted Effect probably benign
Transcript: ENSMUST00000198664
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Atp12a T C 14: 56,372,844 V224A probably damaging Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Hip1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hip1r APN 5 123989735 critical splice donor site probably null
IGL01771:Hip1r APN 5 123999543 missense possibly damaging 0.95
IGL01804:Hip1r APN 5 124001550 critical splice donor site probably null
IGL02100:Hip1r APN 5 123998943 unclassified probably benign
IGL02139:Hip1r APN 5 123996244 missense probably damaging 1.00
IGL02321:Hip1r APN 5 123999890 missense probably damaging 0.99
IGL02562:Hip1r APN 5 123991523 unclassified probably benign
IGL02745:Hip1r APN 5 123990939 splice site probably null
IGL02798:Hip1r APN 5 123994712 unclassified probably benign
IGL03365:Hip1r APN 5 124000167 missense probably damaging 1.00
R0546:Hip1r UTSW 5 123999051 missense possibly damaging 0.89
R0799:Hip1r UTSW 5 123996941 missense probably benign 0.00
R1588:Hip1r UTSW 5 123996575 missense probably damaging 0.98
R1590:Hip1r UTSW 5 124002140 missense probably benign 0.00
R1675:Hip1r UTSW 5 123994820 missense probably damaging 1.00
R1801:Hip1r UTSW 5 123998808 missense probably benign
R1818:Hip1r UTSW 5 123995955 critical splice donor site probably null
R1852:Hip1r UTSW 5 123991505 missense probably benign 0.10
R1936:Hip1r UTSW 5 123996071 missense probably damaging 1.00
R1954:Hip1r UTSW 5 124001844 missense probably damaging 0.96
R1989:Hip1r UTSW 5 123989698 missense probably damaging 1.00
R2045:Hip1r UTSW 5 124000731 missense probably benign
R2105:Hip1r UTSW 5 124000204 missense probably damaging 0.96
R2414:Hip1r UTSW 5 124001243 missense probably damaging 1.00
R2909:Hip1r UTSW 5 124000593 splice site probably null
R3125:Hip1r UTSW 5 124000141 missense probably benign 0.20
R3401:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3402:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3889:Hip1r UTSW 5 124001791 nonsense probably null
R4212:Hip1r UTSW 5 123999890 missense probably benign 0.06
R4421:Hip1r UTSW 5 123997862 missense possibly damaging 0.66
R4422:Hip1r UTSW 5 123997006 missense possibly damaging 0.93
R4713:Hip1r UTSW 5 123989980 missense probably benign 0.02
R6837:Hip1r UTSW 5 123998865 missense possibly damaging 0.63
R7171:Hip1r UTSW 5 123995944 missense probably benign 0.02
R7212:Hip1r UTSW 5 123973782 missense possibly damaging 0.91
R7251:Hip1r UTSW 5 123994750 missense probably damaging 1.00
R7319:Hip1r UTSW 5 123999111 missense probably damaging 1.00
R7432:Hip1r UTSW 5 123991766 missense probably benign 0.05
Z1088:Hip1r UTSW 5 123999132 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCCAATGGCTCCATGAAGGATGAC -3'
(R):5'- TTCCTCTCGAAGGCCCTGGTTG -3'

Sequencing Primer
(F):5'- ACTGCTAGTGACATCTGAGATCC -3'
(R):5'- TTGTCCACCAGGGCCTT -3'
Posted On2013-04-16