Incidental Mutation 'R2275:Adgrb2'
ID242715
Institutional Source Beutler Lab
Gene Symbol Adgrb2
Ensembl Gene ENSMUSG00000028782
Gene Nameadhesion G protein-coupled receptor B2
SynonymsBai2
MMRRC Submission 040274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2275 (G1)
Quality Score81.1
Status Not validated
Chromosome4
Chromosomal Location129984870-130022633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130006854 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 333 (G333D)
Ref Sequence ENSEMBL: ENSMUSP00000112869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]
Predicted Effect probably damaging
Transcript: ENSMUST00000030571
AA Change: G388D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782
AA Change: G388D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:GAIN 600 842 1.6e-41 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 1.7e-67 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097868
AA Change: G388D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782
AA Change: G388D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 1.2e-54 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1159 2.6e-69 PFAM
low complexity region 1324 1338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106012
Predicted Effect probably damaging
Transcript: ENSMUST00000106015
AA Change: G388D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782
AA Change: G388D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.4e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 4.1e-68 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106017
AA Change: G388D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782
AA Change: G388D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.3e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1180 4.6e-68 PFAM
low complexity region 1345 1359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106018
AA Change: G333D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782
AA Change: G333D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 1.1e-54 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 2.4e-69 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120204
SMART Domains Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 8.2e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 9.6e-70 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121049
AA Change: G333D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782
AA Change: G333D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 6.1e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1137 3.8e-68 PFAM
low complexity region 1302 1316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149282
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik A G 3: 108,542,503 N33D possibly damaging Het
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Aco2 C T 15: 81,895,264 R57C probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Arhgef7 T A 8: 11,815,010 F374Y possibly damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Atxn7 T A 14: 14,013,268 M62K possibly damaging Het
C87436 G A 6: 86,445,600 R52H probably damaging Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Cdh4 T C 2: 179,890,847 S701P probably damaging Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Cecr2 C T 6: 120,756,741 S563L probably benign Het
Col12a1 A T 9: 79,635,427 V2352E probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csad G T 15: 102,187,122 R167S probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Ehmt2 T A 17: 34,910,715 N951K possibly damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Enpp2 A C 15: 54,897,794 Y221D probably damaging Het
Exoc3l A T 8: 105,290,447 probably null Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Faiml T C 9: 99,229,559 Y149C probably benign Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Glg1 A T 8: 111,168,721 Y819* probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gm28042 A C 2: 120,036,829 Q465P probably damaging Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
Knl1 C A 2: 119,072,281 Q1488K probably damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mypn A G 10: 63,131,069 F943L probably damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nrarp T C 2: 25,181,409 V100A possibly damaging Het
Nt5c1a T C 4: 123,216,080 F324S probably damaging Het
Ntrk2 T A 13: 58,861,351 Y319N probably damaging Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Parg A G 14: 32,295,238 D384G probably damaging Het
Pde7b T A 10: 20,400,419 *460L probably null Het
Pigr G T 1: 130,846,470 V396L probably benign Het
Pkhd1 A G 1: 20,200,849 I3160T possibly damaging Het
Ppl T C 16: 5,094,552 S722G probably benign Het
Ppp1r26 A G 2: 28,452,701 E781G possibly damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rusc2 G A 4: 43,416,260 R522H probably damaging Het
Senp7 T C 16: 56,184,783 S927P probably damaging Het
Serpinb6d A T 13: 33,671,428 M362L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Slco4a1 T C 2: 180,464,736 L237P possibly damaging Het
Sned1 T A 1: 93,281,642 probably null Het
Tia1 A G 6: 86,427,677 N298S probably benign Het
Tsr1 A T 11: 74,904,827 probably null Het
Ttc6 G A 12: 57,702,298 V1339I probably benign Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r228 A G 17: 20,776,545 L237P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn2r2 T C 3: 64,116,509 R884G probably benign Het
Vmn2r60 T A 7: 42,136,827 Y351* probably null Het
Zbtb7a G A 10: 81,144,997 V342I possibly damaging Het
Zdhhc11 C A 13: 73,973,752 N127K probably damaging Het
Other mutations in Adgrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Adgrb2 APN 4 130018805 missense probably damaging 1.00
IGL00425:Adgrb2 APN 4 130019072 missense probably benign 0.09
IGL00490:Adgrb2 APN 4 130011872 missense possibly damaging 0.82
IGL00928:Adgrb2 APN 4 129992303 missense probably benign
IGL01353:Adgrb2 APN 4 130012300 missense probably damaging 1.00
IGL01521:Adgrb2 APN 4 129992292 missense probably damaging 0.98
IGL01590:Adgrb2 APN 4 130013813 splice site probably benign
IGL01813:Adgrb2 APN 4 130012566 missense probably benign 0.00
IGL01831:Adgrb2 APN 4 130009394 missense probably damaging 1.00
IGL01939:Adgrb2 APN 4 129992132 missense probably damaging 0.99
IGL01960:Adgrb2 APN 4 130012384 splice site probably benign
IGL01993:Adgrb2 APN 4 130018842 missense possibly damaging 0.94
IGL02646:Adgrb2 APN 4 130019282 critical splice donor site probably null
IGL02655:Adgrb2 APN 4 129992179 nonsense probably null
IGL02695:Adgrb2 APN 4 130018832 missense probably damaging 1.00
IGL02998:Adgrb2 APN 4 130019069 missense probably benign 0.15
IGL03372:Adgrb2 APN 4 130017569 missense probably benign 0.42
R0098:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0206:Adgrb2 UTSW 4 129992559 missense probably damaging 1.00
R0311:Adgrb2 UTSW 4 130017129 missense probably damaging 1.00
R0380:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0382:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0492:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0544:Adgrb2 UTSW 4 130017542 missense probably damaging 0.98
R0965:Adgrb2 UTSW 4 129992416 small deletion probably benign
R1458:Adgrb2 UTSW 4 130014591 missense possibly damaging 0.48
R1601:Adgrb2 UTSW 4 129992837 missense probably benign 0.43
R1711:Adgrb2 UTSW 4 129992624 missense probably damaging 1.00
R1758:Adgrb2 UTSW 4 130011875 missense probably damaging 1.00
R1783:Adgrb2 UTSW 4 130009305 missense possibly damaging 0.61
R1827:Adgrb2 UTSW 4 130012557 missense probably damaging 1.00
R1838:Adgrb2 UTSW 4 130010231 missense probably benign 0.00
R1881:Adgrb2 UTSW 4 130010285 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1894:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R2926:Adgrb2 UTSW 4 130008344 missense probably damaging 1.00
R4472:Adgrb2 UTSW 4 130008353 missense probably benign 0.12
R4490:Adgrb2 UTSW 4 130012328 missense possibly damaging 0.91
R4499:Adgrb2 UTSW 4 129992661 missense probably damaging 0.99
R4758:Adgrb2 UTSW 4 130009350 missense probably damaging 1.00
R4900:Adgrb2 UTSW 4 130013875 missense probably damaging 1.00
R4904:Adgrb2 UTSW 4 130012539 missense possibly damaging 0.50
R4922:Adgrb2 UTSW 4 130007852 missense probably damaging 1.00
R5330:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5331:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5550:Adgrb2 UTSW 4 130014934 critical splice acceptor site probably null
R5995:Adgrb2 UTSW 4 130017103 missense probably damaging 1.00
R6047:Adgrb2 UTSW 4 130018705 missense probably damaging 1.00
R6534:Adgrb2 UTSW 4 130022219 missense probably damaging 0.98
R6565:Adgrb2 UTSW 4 130019276 missense probably damaging 1.00
R6813:Adgrb2 UTSW 4 130009491 missense probably damaging 1.00
R6963:Adgrb2 UTSW 4 130014362 frame shift probably null
R6966:Adgrb2 UTSW 4 130014362 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGTAAAATTGCGGAACTCCTG -3'
(R):5'- CCATGCGTGGTCAAAGCTATAG -3'

Sequencing Primer
(F):5'- AAATTGCGGAACTCCTGATTGG -3'
(R):5'- CGTGGTCAAAGCTATAGGAACCC -3'
Posted On2014-10-16