Incidental Mutation 'R2276:Madd'
ID242776
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene NameMAP-kinase activating death domain
SynonymsRab3 GEP, 9630059K23Rik
MMRRC Submission 040275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2276 (G1)
Quality Score178
Status Validated
Chromosome2
Chromosomal Location91137360-91183837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91143683 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1419 (C1419S)
Ref Sequence ENSEMBL: ENSMUSP00000107012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066473
AA Change: C1438S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: C1438S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075269
AA Change: C1380S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: C1380S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077941
AA Change: C1458S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: C1458S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099723
AA Change: C1457S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: C1457S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099725
AA Change: C1438S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: C1438S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111369
AA Change: C1355S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: C1355S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111370
AA Change: C1438S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: C1438S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111371
AA Change: C1400S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: C1400S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111372
AA Change: C1399S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: C1399S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111373
AA Change: C1355S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: C1355S

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111375
AA Change: C1376S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: C1376S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111376
AA Change: C1416S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: C1416S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111381
AA Change: C1419S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: C1419S

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156368
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Ankrd27 T C 7: 35,615,840 probably benign Het
Anxa3 T C 5: 96,830,490 probably null Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cep112 A T 11: 108,855,845 R176S probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cpped1 A C 16: 11,894,881 probably null Het
Cr2 T C 1: 195,157,368 R960G possibly damaging Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dnah6 G A 6: 73,113,581 S2210L probably benign Het
Dnajb12 C T 10: 59,892,977 T229I probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Epb41l2 T C 10: 25,488,944 probably benign Het
Fam178b A G 1: 36,632,458 L194P probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gimap9 A G 6: 48,677,878 H133R probably benign Het
Gpbp1 A T 13: 111,466,978 probably null Het
Gpr89 A G 3: 96,897,427 Y38H probably damaging Het
Gsdmc3 T A 15: 63,860,256 Y307F probably benign Het
Hip1 C T 5: 135,457,046 R101K probably damaging Het
Hist4h4 T A 6: 136,804,301 I27F probably damaging Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Igfn1 T C 1: 135,964,741 K2214E probably damaging Het
Itgal A T 7: 127,328,747 E1038V probably null Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kctd15 T C 7: 34,644,941 D95G possibly damaging Het
Kif1a A T 1: 93,068,477 probably benign Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lrrc7 A G 3: 158,179,792 F432L probably damaging Het
Nisch T C 14: 31,176,846 probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Osbpl2 G A 2: 180,148,526 G198S possibly damaging Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Ptpn4 T C 1: 119,684,591 D24G probably damaging Het
Rars2 T C 4: 34,656,835 S495P probably damaging Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rhou T C 8: 123,655,519 V100A probably damaging Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Scmh1 G T 4: 120,483,672 C185F probably damaging Het
Sema3d A T 5: 12,542,582 Q326L possibly damaging Het
Sis T A 3: 72,914,601 K1376* probably null Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc26a5 A G 5: 21,823,547 V304A probably benign Het
Slc39a7 C T 17: 34,031,267 probably benign Het
Slco1a4 A G 6: 141,815,582 V435A possibly damaging Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tgm5 T A 2: 121,048,823 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem132d G A 5: 127,795,923 R541W probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tpbgl G T 7: 99,626,026 A208E possibly damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Ulk1 T C 5: 110,788,162 E827G probably benign Het
Vps13a A G 19: 16,710,426 V886A possibly damaging Het
Wrn A T 8: 33,324,556 C44S probably benign Het
Zscan22 T A 7: 12,906,823 C331* probably null Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91175766 unclassified probably benign
IGL00781:Madd APN 2 91146928 missense probably benign 0.00
IGL00844:Madd APN 2 91167868 missense probably damaging 1.00
IGL00942:Madd APN 2 91170578 missense probably damaging 1.00
IGL01100:Madd APN 2 91158040 missense probably damaging 1.00
IGL01116:Madd APN 2 91154543 splice site probably benign
IGL01694:Madd APN 2 91157975 splice site probably benign
IGL01982:Madd APN 2 91175707 missense probably damaging 1.00
IGL02346:Madd APN 2 91162491 missense probably damaging 0.97
IGL02354:Madd APN 2 91162198 missense probably benign 0.17
IGL02361:Madd APN 2 91162198 missense probably benign 0.17
IGL02481:Madd APN 2 91178036 missense probably damaging 1.00
IGL02483:Madd APN 2 91178036 missense probably damaging 1.00
IGL02948:Madd APN 2 91142827 missense probably benign
IGL03338:Madd APN 2 91162162 missense possibly damaging 0.48
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0027:Madd UTSW 2 91152549 missense probably damaging 0.97
R0085:Madd UTSW 2 91162738 missense probably benign 0.00
R0577:Madd UTSW 2 91138395 missense possibly damaging 0.88
R0587:Madd UTSW 2 91146885 missense probably damaging 1.00
R1112:Madd UTSW 2 91143599 missense probably damaging 1.00
R1722:Madd UTSW 2 91167637 missense probably benign
R1750:Madd UTSW 2 91167891 missense probably damaging 0.98
R2061:Madd UTSW 2 91161486 intron probably benign
R2112:Madd UTSW 2 91176976 missense possibly damaging 0.89
R2114:Madd UTSW 2 91164022 missense probably damaging 1.00
R2140:Madd UTSW 2 91152509 missense possibly damaging 0.80
R2277:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2279:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2424:Madd UTSW 2 91166622 missense probably damaging 1.00
R2904:Madd UTSW 2 91175672 missense probably damaging 1.00
R3122:Madd UTSW 2 91176209 missense probably damaging 1.00
R3836:Madd UTSW 2 91154643 critical splice donor site probably null
R3979:Madd UTSW 2 91176828 missense possibly damaging 0.81
R4151:Madd UTSW 2 91143083 missense probably benign 0.11
R4233:Madd UTSW 2 91178236 missense probably benign 0.26
R4236:Madd UTSW 2 91167028 missense probably benign 0.00
R4299:Madd UTSW 2 91169803 missense probably damaging 1.00
R4334:Madd UTSW 2 91140572 missense probably benign 0.08
R4413:Madd UTSW 2 91167587 missense probably damaging 1.00
R4595:Madd UTSW 2 91167664 missense possibly damaging 0.80
R4694:Madd UTSW 2 91160328 missense probably damaging 0.99
R5410:Madd UTSW 2 91154514 missense probably damaging 1.00
R5490:Madd UTSW 2 91170635 missense possibly damaging 0.80
R5560:Madd UTSW 2 91163545 missense probably damaging 1.00
R5661:Madd UTSW 2 91154433 critical splice donor site probably null
R5710:Madd UTSW 2 91154476 missense probably damaging 1.00
R5730:Madd UTSW 2 91158109 missense probably damaging 1.00
R5759:Madd UTSW 2 91162075 missense possibly damaging 0.94
R5768:Madd UTSW 2 91167829 missense probably damaging 1.00
R5822:Madd UTSW 2 91152533 missense probably damaging 1.00
R6125:Madd UTSW 2 91152452 critical splice donor site probably null
R6151:Madd UTSW 2 91165457 nonsense probably null
R6229:Madd UTSW 2 91143670 missense probably damaging 0.96
R6230:Madd UTSW 2 91143521 critical splice donor site probably null
R6245:Madd UTSW 2 91178104 missense probably benign 0.27
R6323:Madd UTSW 2 91161438 utr 3 prime probably null
R6456:Madd UTSW 2 91178191 missense probably benign
R6473:Madd UTSW 2 91167059 missense probably benign
R6878:Madd UTSW 2 91169857 missense probably damaging 1.00
R7060:Madd UTSW 2 91177107 missense probably damaging 1.00
R7065:Madd UTSW 2 91155057 missense probably benign 0.26
R7073:Madd UTSW 2 91162509 missense not run
R7124:Madd UTSW 2 91162048 missense not run
X0067:Madd UTSW 2 91152473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACCCTGAGTACCTTCTTGG -3'
(R):5'- GACAGTGCACATTTTCAAAGATTCC -3'

Sequencing Primer
(F):5'- CCTTCTTGGTATAGAACTTGTTGAGC -3'
(R):5'- CAGAAAGTATGTCCATTGCTTGTG -3'
Posted On2014-10-16