Incidental Mutation 'R2276:Ulk1'
ID242796
Institutional Source Beutler Lab
Gene Symbol Ulk1
Ensembl Gene ENSMUSG00000029512
Gene Nameunc-51 like kinase 1
SynonymsUnc51.1
MMRRC Submission 040275-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2276 (G1)
Quality Score214
Status Validated
Chromosome5
Chromosomal Location110784488-110810097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110788162 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 827 (E827G)
Ref Sequence ENSEMBL: ENSMUSP00000143536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031490] [ENSMUST00000196094] [ENSMUST00000198561] [ENSMUST00000200299]
Predicted Effect probably benign
Transcript: ENSMUST00000031490
AA Change: E821G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512
AA Change: E821G

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197768
Predicted Effect probably benign
Transcript: ENSMUST00000198561
SMART Domains Protein: ENSMUSP00000143308
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
Blast:S_TKc 1 75 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200099
Predicted Effect probably benign
Transcript: ENSMUST00000200299
AA Change: E827G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143536
Gene: ENSMUSG00000029512
AA Change: E827G

DomainStartEndE-ValueType
S_TKc 16 278 7.47e-96 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 843 1e-129 BLAST
Pfam:DUF3543 844 1054 1.4e-29 PFAM
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Null homozygotes have blood defects including an increase in mean corpuscular volume and the presence of red blood cells that contain mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Ankrd27 T C 7: 35,615,840 probably benign Het
Anxa3 T C 5: 96,830,490 probably null Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cep112 A T 11: 108,855,845 R176S probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cpped1 A C 16: 11,894,881 probably null Het
Cr2 T C 1: 195,157,368 R960G possibly damaging Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dnah6 G A 6: 73,113,581 S2210L probably benign Het
Dnajb12 C T 10: 59,892,977 T229I probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Epb41l2 T C 10: 25,488,944 probably benign Het
Fam178b A G 1: 36,632,458 L194P probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gimap9 A G 6: 48,677,878 H133R probably benign Het
Gpbp1 A T 13: 111,466,978 probably null Het
Gpr89 A G 3: 96,897,427 Y38H probably damaging Het
Gsdmc3 T A 15: 63,860,256 Y307F probably benign Het
Hip1 C T 5: 135,457,046 R101K probably damaging Het
Hist4h4 T A 6: 136,804,301 I27F probably damaging Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Igfn1 T C 1: 135,964,741 K2214E probably damaging Het
Itgal A T 7: 127,328,747 E1038V probably null Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kctd15 T C 7: 34,644,941 D95G possibly damaging Het
Kif1a A T 1: 93,068,477 probably benign Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lrrc7 A G 3: 158,179,792 F432L probably damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Nisch T C 14: 31,176,846 probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Osbpl2 G A 2: 180,148,526 G198S possibly damaging Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Ptpn4 T C 1: 119,684,591 D24G probably damaging Het
Rars2 T C 4: 34,656,835 S495P probably damaging Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rhou T C 8: 123,655,519 V100A probably damaging Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Scmh1 G T 4: 120,483,672 C185F probably damaging Het
Sema3d A T 5: 12,542,582 Q326L possibly damaging Het
Sis T A 3: 72,914,601 K1376* probably null Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc26a5 A G 5: 21,823,547 V304A probably benign Het
Slc39a7 C T 17: 34,031,267 probably benign Het
Slco1a4 A G 6: 141,815,582 V435A possibly damaging Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tgm5 T A 2: 121,048,823 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem132d G A 5: 127,795,923 R541W probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tpbgl G T 7: 99,626,026 A208E possibly damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Vps13a A G 19: 16,710,426 V886A possibly damaging Het
Wrn A T 8: 33,324,556 C44S probably benign Het
Zscan22 T A 7: 12,906,823 C331* probably null Het
Other mutations in Ulk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ulk1 APN 5 110787872 missense probably damaging 1.00
IGL00916:Ulk1 APN 5 110793011 missense probably damaging 1.00
IGL00951:Ulk1 APN 5 110792404 missense possibly damaging 0.85
IGL02404:Ulk1 APN 5 110796234 splice site probably null
IGL02415:Ulk1 APN 5 110787621 missense probably damaging 1.00
IGL02500:Ulk1 APN 5 110809134 missense probably damaging 1.00
IGL02696:Ulk1 APN 5 110793052 missense probably damaging 1.00
R0086:Ulk1 UTSW 5 110787707 splice site probably benign
R0092:Ulk1 UTSW 5 110796327 missense probably null 1.00
R0158:Ulk1 UTSW 5 110788944 splice site probably benign
R0387:Ulk1 UTSW 5 110788797 missense possibly damaging 0.91
R0453:Ulk1 UTSW 5 110791085 missense probably damaging 1.00
R0837:Ulk1 UTSW 5 110789545 splice site probably benign
R1244:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1245:Ulk1 UTSW 5 110789340 critical splice donor site probably null
R1268:Ulk1 UTSW 5 110790277 missense probably damaging 1.00
R1342:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1586:Ulk1 UTSW 5 110789516 missense probably damaging 1.00
R1590:Ulk1 UTSW 5 110795766 missense probably damaging 1.00
R1816:Ulk1 UTSW 5 110787831 missense probably damaging 1.00
R1837:Ulk1 UTSW 5 110789381 missense probably damaging 1.00
R1924:Ulk1 UTSW 5 110791070 missense probably damaging 0.97
R1992:Ulk1 UTSW 5 110787151 missense probably damaging 1.00
R2126:Ulk1 UTSW 5 110792436 missense probably benign 0.27
R2310:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2311:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2312:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2764:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2859:Ulk1 UTSW 5 110794629 missense probably damaging 1.00
R2932:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3761:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4334:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4419:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4471:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4615:Ulk1 UTSW 5 110789046 missense probably damaging 1.00
R4776:Ulk1 UTSW 5 110788947 critical splice donor site probably null
R4820:Ulk1 UTSW 5 110792130 missense probably benign
R4912:Ulk1 UTSW 5 110787589 missense probably damaging 1.00
R6299:Ulk1 UTSW 5 110791097 missense possibly damaging 0.78
R6754:Ulk1 UTSW 5 110790393 missense possibly damaging 0.91
R7233:Ulk1 UTSW 5 110809042 missense probably damaging 1.00
X0025:Ulk1 UTSW 5 110792129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCTCTTGCTGAGAAGGC -3'
(R):5'- ATGAGTTCAGAGTGCCTGTCC -3'

Sequencing Primer
(F):5'- CTCCCAAGTGTATACAGCAGGG -3'
(R):5'- AGAGTGCCTGTCCCTTACCAG -3'
Posted On2014-10-16