Incidental Mutation 'R2278:Clca3a1'
ID242888
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Namechloride channel accessory 3A1
SynonymsClca1
MMRRC Submission 040277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2278 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144729677-144760977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144758024 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000029932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
Predicted Effect probably damaging
Transcript: ENSMUST00000029932
AA Change: V164A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: V164A

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059091
AA Change: V164A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: V164A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,711,384 D251G probably damaging Het
Aqp3 T C 4: 41,093,836 D219G probably damaging Het
Arhgef15 C A 11: 68,951,691 W404C probably damaging Het
Bdp1 C A 13: 100,061,330 S849I probably benign Het
Bdp1 T A 13: 100,061,339 E846V probably damaging Het
Bmp5 T A 9: 75,776,548 N152K possibly damaging Het
Bpifb2 C T 2: 153,878,479 Q53* probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Gcn1l1 T C 5: 115,611,175 I1922T probably damaging Het
Gnpat A G 8: 124,876,920 D179G probably benign Het
Hook1 A G 4: 95,998,720 Q188R probably benign Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Ifi44 T C 3: 151,732,388 N421D probably benign Het
Igdcc4 C T 9: 65,130,743 T801I probably damaging Het
Itgad T C 7: 128,205,170 S107P possibly damaging Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kcnk18 T C 19: 59,235,494 I357T probably damaging Het
Kcnma1 T A 14: 23,543,083 R120* probably null Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lypla1 T G 1: 4,841,098 probably null Het
Mknk1 C T 4: 115,875,493 A306V probably damaging Het
Ncoa6 A T 2: 155,407,650 S1245T possibly damaging Het
Npas3 T A 12: 53,640,502 V122E possibly damaging Het
Nrxn2 G C 19: 6,481,853 Q789H probably damaging Het
Olfr1135 A G 2: 87,671,945 C141R possibly damaging Het
Olfr410 T C 11: 74,335,165 E22G probably benign Het
Olfr494 T C 7: 108,368,081 V197A probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Otog G A 7: 46,300,044 V2369M probably damaging Het
Pfkp T C 13: 6,619,209 probably null Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prune2 A G 19: 17,118,555 I474M possibly damaging Het
Psg22 C A 7: 18,726,837 Q464K possibly damaging Het
Rp1 C T 1: 4,348,027 S954N possibly damaging Het
Rps27l T A 9: 66,946,926 D34E probably benign Het
Sae1 A C 7: 16,370,366 L106R probably damaging Het
Siglec1 T A 2: 131,071,337 Q1553L probably benign Het
Slc11a2 A G 15: 100,410,081 probably null Het
Slc14a2 A T 18: 78,159,944 M556K probably benign Het
Slk T G 19: 47,619,749 I380M probably damaging Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tiam2 G A 17: 3,427,220 V573M probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tmem255b C T 8: 13,451,081 A106V probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Vps13c A G 9: 67,939,072 M2141V probably benign Het
Vwa5a T C 9: 38,723,207 Y143H probably damaging Het
Zfp280d T A 9: 72,338,773 C707* probably null Het
Zfp668 A T 7: 127,866,826 N395K probably benign Het
Znhit6 G T 3: 145,576,236 probably benign Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Clca3a1 APN 3 144755251 missense probably damaging 0.96
IGL01331:Clca3a1 APN 3 144747512 missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144747572 nonsense probably null
IGL01940:Clca3a1 APN 3 144746976 missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144754803 missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144751929 splice site probably benign
IGL03093:Clca3a1 APN 3 144747501 missense probably damaging 0.99
Lucha UTSW 3 144749689 missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144730879 missense probably damaging 0.98
R0513:Clca3a1 UTSW 3 144760562 critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144748394 splice site probably benign
R1522:Clca3a1 UTSW 3 144755171 missense probably benign 0.01
R1744:Clca3a1 UTSW 3 144746835 missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144746829 missense probably damaging 0.99
R2238:Clca3a1 UTSW 3 144752005 missense possibly damaging 0.94
R2516:Clca3a1 UTSW 3 144737858 splice site probably null
R3737:Clca3a1 UTSW 3 144730721 missense probably benign 0.01
R3981:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144755233 missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144760722 start codon destroyed probably benign 0.08
R4543:Clca3a1 UTSW 3 144746988 missense probably damaging 1.00
R4766:Clca3a1 UTSW 3 144749712 missense probably damaging 1.00
R4899:Clca3a1 UTSW 3 144737961 missense probably damaging 1.00
R5090:Clca3a1 UTSW 3 144737872 missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144730722 missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144746784 missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144737136 missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144737005 missense possibly damaging 0.77
R5871:Clca3a1 UTSW 3 144754881 missense probably damaging 1.00
R5907:Clca3a1 UTSW 3 144749642 intron probably benign
R5976:Clca3a1 UTSW 3 144746875 missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144758060 missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144759232 missense possibly damaging 0.65
R6263:Clca3a1 UTSW 3 144749778 missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144758514 missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144730797 missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144759259 missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144759260 missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144736947 missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144749689 missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144747568 missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144755206 missense probably damaging 0.97
R7139:Clca3a1 UTSW 3 144755302 missense possibly damaging 0.58
Z1088:Clca3a1 UTSW 3 144746953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCATTCCAAGGCACCAG -3'
(R):5'- AGCCTTCACTAACACCTGTG -3'

Sequencing Primer
(F):5'- GGCACCAGAACTAATCAAATATGTG -3'
(R):5'- GATAGTTATATCCCACCTATTTGTGC -3'
Posted On2014-10-16