Incidental Mutation 'R2278:Spink5'
ID242934
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
MMRRC Submission 040277-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2278 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43986329 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 236 (N236D)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably benign
Transcript: ENSMUST00000069245
AA Change: N236D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: N236D

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,711,384 D251G probably damaging Het
Aqp3 T C 4: 41,093,836 D219G probably damaging Het
Arhgef15 C A 11: 68,951,691 W404C probably damaging Het
Bdp1 C A 13: 100,061,330 S849I probably benign Het
Bdp1 T A 13: 100,061,339 E846V probably damaging Het
Bmp5 T A 9: 75,776,548 N152K possibly damaging Het
Bpifb2 C T 2: 153,878,479 Q53* probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca3a1 A G 3: 144,758,024 V164A probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Gcn1l1 T C 5: 115,611,175 I1922T probably damaging Het
Gnpat A G 8: 124,876,920 D179G probably benign Het
Hook1 A G 4: 95,998,720 Q188R probably benign Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Ifi44 T C 3: 151,732,388 N421D probably benign Het
Igdcc4 C T 9: 65,130,743 T801I probably damaging Het
Itgad T C 7: 128,205,170 S107P possibly damaging Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kcnk18 T C 19: 59,235,494 I357T probably damaging Het
Kcnma1 T A 14: 23,543,083 R120* probably null Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lypla1 T G 1: 4,841,098 probably null Het
Mknk1 C T 4: 115,875,493 A306V probably damaging Het
Ncoa6 A T 2: 155,407,650 S1245T possibly damaging Het
Npas3 T A 12: 53,640,502 V122E possibly damaging Het
Nrxn2 G C 19: 6,481,853 Q789H probably damaging Het
Olfr1135 A G 2: 87,671,945 C141R possibly damaging Het
Olfr410 T C 11: 74,335,165 E22G probably benign Het
Olfr494 T C 7: 108,368,081 V197A probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Otog G A 7: 46,300,044 V2369M probably damaging Het
Pfkp T C 13: 6,619,209 probably null Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prune2 A G 19: 17,118,555 I474M possibly damaging Het
Psg22 C A 7: 18,726,837 Q464K possibly damaging Het
Rp1 C T 1: 4,348,027 S954N possibly damaging Het
Rps27l T A 9: 66,946,926 D34E probably benign Het
Sae1 A C 7: 16,370,366 L106R probably damaging Het
Siglec1 T A 2: 131,071,337 Q1553L probably benign Het
Slc11a2 A G 15: 100,410,081 probably null Het
Slc14a2 A T 18: 78,159,944 M556K probably benign Het
Slk T G 19: 47,619,749 I380M probably damaging Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tiam2 G A 17: 3,427,220 V573M probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tmem255b C T 8: 13,451,081 A106V probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Vps13c A G 9: 67,939,072 M2141V probably benign Het
Vwa5a T C 9: 38,723,207 Y143H probably damaging Het
Zfp280d T A 9: 72,338,773 C707* probably null Het
Zfp668 A T 7: 127,866,826 N395K probably benign Het
Znhit6 G T 3: 145,576,236 probably benign Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
Predicted Primers PCR Primer
(F):5'- TACACAGGTCTTTAGAGTGCC -3'
(R):5'- AAACCCTCACTGACTACTGCTG -3'

Sequencing Primer
(F):5'- ACAGGTCTTTAGAGTGCCGAGTAATG -3'
(R):5'- GACTACTGCTGCTATTCATCAATC -3'
Posted On2014-10-16