Incidental Mutation 'R2278:Slc14a2'
ID242935
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
MMRRC Submission 040277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2278 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78159944 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 556 (M556K)
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434]
Predicted Effect probably benign
Transcript: ENSMUST00000025434
AA Change: M556K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: M556K

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,711,384 D251G probably damaging Het
Aqp3 T C 4: 41,093,836 D219G probably damaging Het
Arhgef15 C A 11: 68,951,691 W404C probably damaging Het
Bdp1 C A 13: 100,061,330 S849I probably benign Het
Bdp1 T A 13: 100,061,339 E846V probably damaging Het
Bmp5 T A 9: 75,776,548 N152K possibly damaging Het
Bpifb2 C T 2: 153,878,479 Q53* probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca3a1 A G 3: 144,758,024 V164A probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Gcn1l1 T C 5: 115,611,175 I1922T probably damaging Het
Gnpat A G 8: 124,876,920 D179G probably benign Het
Hook1 A G 4: 95,998,720 Q188R probably benign Het
Hsf4 G A 8: 105,269,996 D18N probably null Het
Ifi44 T C 3: 151,732,388 N421D probably benign Het
Igdcc4 C T 9: 65,130,743 T801I probably damaging Het
Itgad T C 7: 128,205,170 S107P possibly damaging Het
Kank2 C A 9: 21,769,784 M816I probably damaging Het
Kcnk18 T C 19: 59,235,494 I357T probably damaging Het
Kcnma1 T A 14: 23,543,083 R120* probably null Het
Lgi4 T G 7: 31,060,612 L78V probably damaging Het
Lypla1 T G 1: 4,841,098 probably null Het
Mknk1 C T 4: 115,875,493 A306V probably damaging Het
Ncoa6 A T 2: 155,407,650 S1245T possibly damaging Het
Npas3 T A 12: 53,640,502 V122E possibly damaging Het
Nrxn2 G C 19: 6,481,853 Q789H probably damaging Het
Olfr1135 A G 2: 87,671,945 C141R possibly damaging Het
Olfr410 T C 11: 74,335,165 E22G probably benign Het
Olfr494 T C 7: 108,368,081 V197A probably benign Het
Olfr93 A T 17: 37,151,254 C239* probably null Het
Otog G A 7: 46,300,044 V2369M probably damaging Het
Pfkp T C 13: 6,619,209 probably null Het
Pja2 T C 17: 64,292,870 S478G probably damaging Het
Prune2 A G 19: 17,118,555 I474M possibly damaging Het
Psg22 C A 7: 18,726,837 Q464K possibly damaging Het
Rp1 C T 1: 4,348,027 S954N possibly damaging Het
Rps27l T A 9: 66,946,926 D34E probably benign Het
Sae1 A C 7: 16,370,366 L106R probably damaging Het
Siglec1 T A 2: 131,071,337 Q1553L probably benign Het
Slc11a2 A G 15: 100,410,081 probably null Het
Slk T G 19: 47,619,749 I380M probably damaging Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Tiam2 G A 17: 3,427,220 V573M probably damaging Het
Tmem170 C A 8: 111,869,717 V59L probably benign Het
Tmem255b C T 8: 13,451,081 A106V probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Vps13c A G 9: 67,939,072 M2141V probably benign Het
Vwa5a T C 9: 38,723,207 Y143H probably damaging Het
Zfp280d T A 9: 72,338,773 C707* probably null Het
Zfp668 A T 7: 127,866,826 N395K probably benign Het
Znhit6 G T 3: 145,576,236 probably benign Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
R7038:Slc14a2 UTSW 18 78159037 missense probably damaging 0.98
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATAGCACATGTAGCTTGTCGG -3'
(R):5'- CTGTAAATCTCAGCTTGGTCCG -3'

Sequencing Primer
(F):5'- CTTGTCGGAGATGTCCCAGAAAG -3'
(R):5'- AGCTTGGTCCGCCCCTAC -3'
Posted On2014-10-16