Incidental Mutation 'R2279:Dspp'
ID242967
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 040278-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2279 (G1)
Quality Score175
Status Not validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104178384 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 871 (S871N)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect unknown
Transcript: ENSMUST00000112771
AA Change: S871N
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: S871N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T C 10: 77,981,642 Y68H probably damaging Het
Ankrd17 G T 5: 90,264,717 N1249K probably damaging Het
Anks1b T C 10: 90,050,096 M218T probably damaging Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cabin1 T C 10: 75,753,461 I87M probably benign Het
Cdc42bpa A G 1: 180,036,919 N149D probably damaging Het
Cdh20 C A 1: 104,947,414 A307E probably damaging Het
Cdk18 A T 1: 132,115,952 Y385N probably damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cptp A G 4: 155,866,421 I196T probably damaging Het
Cyp4b1 T A 4: 115,640,360 Y147F probably benign Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dbr1 G T 9: 99,580,147 Q166H probably benign Het
Ddx42 T A 11: 106,242,939 D580E probably damaging Het
Dnah17 T C 11: 118,096,561 K1308E possibly damaging Het
Dpep1 A T 8: 123,194,144 D21V probably benign Het
En1 T A 1: 120,607,187 *402K probably null Het
Eogt G T 6: 97,134,301 R200S probably benign Het
Epb41l3 A G 17: 69,270,650 T542A possibly damaging Het
Fam198a T C 9: 121,965,602 I274T probably benign Het
Fam208a A C 14: 27,442,495 K253Q probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gh T C 11: 106,300,787 E143G probably damaging Het
Hcn3 C A 3: 89,147,861 R693L probably benign Het
Htra1 A T 7: 130,962,022 I208F probably damaging Het
Ifna13 T A 4: 88,643,919 E156V probably benign Het
Ints6 A G 14: 62,704,682 probably null Het
Kifc5b A G 17: 26,925,541 I545V probably damaging Het
Lrrc4c C T 2: 97,630,505 S492F possibly damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Map2k6 T C 11: 110,499,464 S275P probably damaging Het
Mpp2 T C 11: 102,064,301 E166G probably damaging Het
Mrpl48 G A 7: 100,565,264 T48I probably damaging Het
Neu1 A G 17: 34,934,374 D291G probably damaging Het
Nktr A G 9: 121,731,537 K116E possibly damaging Het
Npc1 T C 18: 12,197,179 probably null Het
Olfr1046 T C 2: 86,216,804 E302G probably benign Het
Olfr6 A T 7: 106,956,627 M103K probably benign Het
Olfr786 A T 10: 129,437,657 M282L probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rnf32 G T 5: 29,225,280 V366F probably benign Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Sirt7 T C 11: 120,624,495 S112G probably damaging Het
Slc1a6 A T 10: 78,789,048 M96L probably benign Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc30a2 G T 4: 134,348,546 Q210H probably benign Het
Sorcs2 A T 5: 36,042,086 probably null Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Sytl3 A G 17: 6,708,874 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem45a A T 16: 56,823,519 L89Q probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Txlna T C 4: 129,632,142 E304G probably damaging Het
Zfp709 T C 8: 71,889,090 V121A probably benign Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCAGTGACAGCAGTGAC -3'
(R):5'- TGAGTGGTTACTGTCACTGCC -3'

Sequencing Primer
(F):5'- TGACAGCAGTGACAGCAGC -3'
(R):5'- AGTGGTTACTGTCACTGCCTTCAC -3'
Posted On2014-10-16