Incidental Mutation 'R2279:Slc1a6'
ID242982
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission 040278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2279 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78789048 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 96 (M96L)
Ref Sequence ENSEMBL: ENSMUSP00000151544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490] [ENSMUST00000217717]
Predicted Effect probably benign
Transcript: ENSMUST00000005490
AA Change: M96L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: M96L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217717
AA Change: M96L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T C 10: 77,981,642 Y68H probably damaging Het
Ankrd17 G T 5: 90,264,717 N1249K probably damaging Het
Anks1b T C 10: 90,050,096 M218T probably damaging Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cabin1 T C 10: 75,753,461 I87M probably benign Het
Cdc42bpa A G 1: 180,036,919 N149D probably damaging Het
Cdh20 C A 1: 104,947,414 A307E probably damaging Het
Cdk18 A T 1: 132,115,952 Y385N probably damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cptp A G 4: 155,866,421 I196T probably damaging Het
Cyp4b1 T A 4: 115,640,360 Y147F probably benign Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dbr1 G T 9: 99,580,147 Q166H probably benign Het
Ddx42 T A 11: 106,242,939 D580E probably damaging Het
Dnah17 T C 11: 118,096,561 K1308E possibly damaging Het
Dpep1 A T 8: 123,194,144 D21V probably benign Het
Dspp G A 5: 104,178,384 S871N unknown Het
En1 T A 1: 120,607,187 *402K probably null Het
Eogt G T 6: 97,134,301 R200S probably benign Het
Epb41l3 A G 17: 69,270,650 T542A possibly damaging Het
Fam198a T C 9: 121,965,602 I274T probably benign Het
Fam208a A C 14: 27,442,495 K253Q probably damaging Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gh T C 11: 106,300,787 E143G probably damaging Het
Hcn3 C A 3: 89,147,861 R693L probably benign Het
Htra1 A T 7: 130,962,022 I208F probably damaging Het
Ifna13 T A 4: 88,643,919 E156V probably benign Het
Ints6 A G 14: 62,704,682 probably null Het
Kifc5b A G 17: 26,925,541 I545V probably damaging Het
Lrrc4c C T 2: 97,630,505 S492F possibly damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Map2k6 T C 11: 110,499,464 S275P probably damaging Het
Mpp2 T C 11: 102,064,301 E166G probably damaging Het
Mrpl48 G A 7: 100,565,264 T48I probably damaging Het
Neu1 A G 17: 34,934,374 D291G probably damaging Het
Nktr A G 9: 121,731,537 K116E possibly damaging Het
Npc1 T C 18: 12,197,179 probably null Het
Olfr1046 T C 2: 86,216,804 E302G probably benign Het
Olfr6 A T 7: 106,956,627 M103K probably benign Het
Olfr786 A T 10: 129,437,657 M282L probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rnf32 G T 5: 29,225,280 V366F probably benign Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Sirt7 T C 11: 120,624,495 S112G probably damaging Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc30a2 G T 4: 134,348,546 Q210H probably benign Het
Sorcs2 A T 5: 36,042,086 probably null Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Sytl3 A G 17: 6,708,874 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem45a A T 16: 56,823,519 L89Q probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Txlna T C 4: 129,632,142 E304G probably damaging Het
Zfp709 T C 8: 71,889,090 V121A probably benign Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78812812 missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
R7548:Slc1a6 UTSW 10 78814431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCATAGAATATTCACTGCTTACC -3'
(R):5'- AGTTCATGTGACAGCAGGGC -3'

Sequencing Primer
(F):5'- ATAGAATATTCACTGCTTACCCTACC -3'
(R):5'- TTCATGTGACAGCAGGGCATAAG -3'
Posted On2014-10-16