Incidental Mutation 'R2279:Fam208a'
ID242998
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 040278-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2279 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 27442495 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 253 (K253Q)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably damaging
Transcript: ENSMUST00000022450
AA Change: K253Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: K253Q

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223970
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T C 10: 77,981,642 Y68H probably damaging Het
Ankrd17 G T 5: 90,264,717 N1249K probably damaging Het
Anks1b T C 10: 90,050,096 M218T probably damaging Het
Arfgef2 G C 2: 166,865,759 G1025A probably benign Het
Arhgap21 T C 2: 20,863,226 I829V possibly damaging Het
Arhgap42 T C 9: 9,035,511 M277V probably benign Het
Cabin1 T C 10: 75,753,461 I87M probably benign Het
Cdc42bpa A G 1: 180,036,919 N149D probably damaging Het
Cdh20 C A 1: 104,947,414 A307E probably damaging Het
Cdk18 A T 1: 132,115,952 Y385N probably damaging Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cptp A G 4: 155,866,421 I196T probably damaging Het
Cyp4b1 T A 4: 115,640,360 Y147F probably benign Het
Dbf4 T C 5: 8,421,333 N36S possibly damaging Het
Dbr1 G T 9: 99,580,147 Q166H probably benign Het
Ddx42 T A 11: 106,242,939 D580E probably damaging Het
Dnah17 T C 11: 118,096,561 K1308E possibly damaging Het
Dpep1 A T 8: 123,194,144 D21V probably benign Het
Dspp G A 5: 104,178,384 S871N unknown Het
En1 T A 1: 120,607,187 *402K probably null Het
Eogt G T 6: 97,134,301 R200S probably benign Het
Epb41l3 A G 17: 69,270,650 T542A possibly damaging Het
Fam198a T C 9: 121,965,602 I274T probably benign Het
Fam50b C T 13: 34,746,840 Q100* probably null Het
Gh T C 11: 106,300,787 E143G probably damaging Het
Hcn3 C A 3: 89,147,861 R693L probably benign Het
Htra1 A T 7: 130,962,022 I208F probably damaging Het
Ifna13 T A 4: 88,643,919 E156V probably benign Het
Ints6 A G 14: 62,704,682 probably null Het
Kifc5b A G 17: 26,925,541 I545V probably damaging Het
Lrrc4c C T 2: 97,630,505 S492F possibly damaging Het
Madd A T 2: 91,143,683 C1419S possibly damaging Het
Map2k6 T C 11: 110,499,464 S275P probably damaging Het
Mpp2 T C 11: 102,064,301 E166G probably damaging Het
Mrpl48 G A 7: 100,565,264 T48I probably damaging Het
Neu1 A G 17: 34,934,374 D291G probably damaging Het
Nktr A G 9: 121,731,537 K116E possibly damaging Het
Npc1 T C 18: 12,197,179 probably null Het
Olfr1046 T C 2: 86,216,804 E302G probably benign Het
Olfr6 A T 7: 106,956,627 M103K probably benign Het
Olfr786 A T 10: 129,437,657 M282L probably benign Het
Pclo T A 5: 14,714,273 D4253E unknown Het
Phactr1 A T 13: 43,077,789 S244C possibly damaging Het
Prex1 A T 2: 166,577,955 I79N probably benign Het
Rhebl1 A T 15: 98,878,286 D162E probably benign Het
Rnf32 G T 5: 29,225,280 V366F probably benign Het
Rpn2 A G 2: 157,310,288 T394A possibly damaging Het
Ryr3 A T 2: 112,649,319 M4386K possibly damaging Het
Sirt7 T C 11: 120,624,495 S112G probably damaging Het
Slc1a6 A T 10: 78,789,048 M96L probably benign Het
Slc25a29 T C 12: 108,826,926 E242G probably benign Het
Slc30a2 G T 4: 134,348,546 Q210H probably benign Het
Sorcs2 A T 5: 36,042,086 probably null Het
Spink5 A G 18: 43,986,329 N236D probably benign Het
Syne2 A G 12: 75,927,466 E1146G possibly damaging Het
Sytl3 A G 17: 6,708,874 probably benign Het
Tgm7 A G 2: 121,098,564 S284P probably damaging Het
Tmem45a A T 16: 56,823,519 L89Q probably damaging Het
Ttc23l A G 15: 10,523,592 I347T possibly damaging Het
Txlna T C 4: 129,632,142 E304G probably damaging Het
Zfp709 T C 8: 71,889,090 V121A probably benign Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTGACATGACTTTAGGAGTTTGAG -3'
(R):5'- ATGCAAGCTCCTGTATCAGC -3'

Sequencing Primer
(F):5'- GAGCTATGTCACTGCCAGCATC -3'
(R):5'- GCTCCTGTATCAGCACACAAAAAG -3'
Posted On2014-10-16