Incidental Mutation 'R2280:Zfp12'
ID243036
Institutional Source Beutler Lab
Gene Symbol Zfp12
Ensembl Gene ENSMUSG00000029587
Gene Namezinc finger protein 12
SynonymsZfp-12, Krox-7
MMRRC Submission 040279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2280 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143235163-143248834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143245493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 525 (Y525C)
Ref Sequence ENSEMBL: ENSMUSP00000076693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032591] [ENSMUST00000075916] [ENSMUST00000077485] [ENSMUST00000161448]
Predicted Effect probably benign
Transcript: ENSMUST00000032591
AA Change: Y557C

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032591
Gene: ENSMUSG00000029587
AA Change: Y557C

DomainStartEndE-ValueType
KRAB 8 68 1.98e-36 SMART
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 263 285 4.47e-3 SMART
ZnF_C2H2 291 313 2.43e-4 SMART
ZnF_C2H2 319 341 2.61e-4 SMART
ZnF_C2H2 347 369 1.04e-3 SMART
ZnF_C2H2 375 397 6.08e-5 SMART
ZnF_C2H2 403 425 2.99e-4 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 2.57e-3 SMART
ZnF_C2H2 487 509 6.32e-3 SMART
ZnF_C2H2 515 537 5.21e-4 SMART
ZnF_C2H2 543 565 9.44e-2 SMART
ZnF_C2H2 571 593 1.72e-4 SMART
ZnF_C2H2 599 621 2.86e-1 SMART
ZnF_C2H2 627 649 3.63e-3 SMART
ZnF_C2H2 655 677 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075916
SMART Domains Protein: ENSMUSP00000137971
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 67 6.65e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077485
AA Change: Y525C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076693
Gene: ENSMUSG00000029587
AA Change: Y525C

DomainStartEndE-ValueType
KRAB 8 68 8.91e-21 SMART
low complexity region 156 167 N/A INTRINSIC
Pfam:zf-C2H2_6 183 200 8.8e-1 PFAM
ZnF_C2H2 231 253 4.47e-3 SMART
ZnF_C2H2 259 281 2.43e-4 SMART
ZnF_C2H2 287 309 2.61e-4 SMART
ZnF_C2H2 315 337 1.04e-3 SMART
ZnF_C2H2 343 365 6.08e-5 SMART
ZnF_C2H2 371 393 2.99e-4 SMART
ZnF_C2H2 399 421 9.08e-4 SMART
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 6.32e-3 SMART
ZnF_C2H2 483 505 5.21e-4 SMART
ZnF_C2H2 511 533 9.44e-2 SMART
ZnF_C2H2 539 561 1.72e-4 SMART
ZnF_C2H2 567 589 2.86e-1 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160195
Predicted Effect probably benign
Transcript: ENSMUST00000161448
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197349
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with eight C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in developmental control of gene expression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,677,973 N2698S probably damaging Het
Ankrd37 T C 8: 45,999,376 T19A probably benign Het
Anks1b A C 10: 90,966,302 K353N probably damaging Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3b1 A G 13: 94,528,216 M888V unknown Het
Apoh T A 11: 108,409,180 Y218* probably null Het
Arhgef19 G A 4: 141,246,516 G105S probably benign Het
Brd7 A G 8: 88,342,757 S437P probably benign Het
Cacna2d4 A T 6: 119,350,041 Q1089L possibly damaging Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cep170 A T 1: 176,774,505 V345E probably benign Het
Chaf1b T G 16: 93,891,571 Y185D probably damaging Het
Clasp1 C T 1: 118,565,183 P1153S probably benign Het
Clvs2 A T 10: 33,528,500 I240N probably damaging Het
Cox8c A T 12: 102,899,454 H30L possibly damaging Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp46a1 T C 12: 108,355,471 S319P probably damaging Het
Dcdc5 G A 2: 106,372,522 noncoding transcript Het
Ddx4 T C 13: 112,620,656 I377V probably benign Het
Dis3l T A 9: 64,317,794 N407I possibly damaging Het
Dysf A C 6: 84,064,494 T161P probably damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Ei24 A G 9: 36,782,339 probably null Het
Fbxl19 A T 7: 127,748,368 D32V possibly damaging Het
Fgd5 G A 6: 91,988,945 V562M possibly damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Frem2 A G 3: 53,572,423 C1950R probably damaging Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Gbx2 A T 1: 89,930,637 V40D probably damaging Het
Gcc2 C A 10: 58,269,680 T210K probably benign Het
Gcn1l1 T A 5: 115,612,730 M1991K probably damaging Het
Gm6768 A G 12: 119,262,838 noncoding transcript Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gpr18 T A 14: 121,912,605 T3S probably benign Het
Herc2 A C 7: 56,137,271 K1621N possibly damaging Het
Hspg2 A G 4: 137,522,043 E1300G probably damaging Het
Krtap19-5 C T 16: 88,896,343 C27Y unknown Het
Lrrc3b A T 14: 15,358,076 L177M probably damaging Het
Mthfd1 T C 12: 76,280,492 I118T probably benign Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Npy1r C T 8: 66,704,059 L44F possibly damaging Het
Olfr433 C A 1: 174,042,521 S190R probably benign Het
Pcx C A 19: 4,604,543 R328S probably damaging Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Pum1 A T 4: 130,766,011 I696F probably damaging Het
Pxdn T C 12: 29,984,906 V254A probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rsph4a A T 10: 33,911,599 I584L probably benign Het
Scamp5 A G 9: 57,445,439 V149A probably benign Het
Sike1 A G 3: 102,997,378 H134R possibly damaging Het
Slc12a9 A G 5: 137,332,212 L77P probably damaging Het
Taar7f G A 10: 24,049,519 A4T probably benign Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tpsg1 C T 17: 25,374,042 R94C probably damaging Het
Utp20 A T 10: 88,825,503 probably null Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Zfyve26 T A 12: 79,275,040 Q935L probably damaging Het
Other mutations in Zfp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Zfp12 APN 5 143244796 missense probably damaging 1.00
IGL02870:Zfp12 APN 5 143245331 missense probably damaging 0.99
IGL02975:Zfp12 APN 5 143244059 unclassified probably benign
R0362:Zfp12 UTSW 5 143245223 missense probably damaging 0.97
R0723:Zfp12 UTSW 5 143244883 missense probably damaging 1.00
R1104:Zfp12 UTSW 5 143245745 missense probably damaging 1.00
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1774:Zfp12 UTSW 5 143245229 missense probably damaging 1.00
R1895:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R1946:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R3824:Zfp12 UTSW 5 143240322 missense probably benign 0.12
R4772:Zfp12 UTSW 5 143240000 missense probably damaging 1.00
R4786:Zfp12 UTSW 5 143245502 missense probably damaging 0.99
R5255:Zfp12 UTSW 5 143240379 missense probably null 0.08
R5496:Zfp12 UTSW 5 143244795 nonsense probably null
R5542:Zfp12 UTSW 5 143244485 missense possibly damaging 0.75
R5637:Zfp12 UTSW 5 143245696 missense probably damaging 1.00
R5742:Zfp12 UTSW 5 143245190 missense probably damaging 1.00
R5907:Zfp12 UTSW 5 143239988 missense probably damaging 1.00
R6701:Zfp12 UTSW 5 143244464 missense probably benign 0.21
R7166:Zfp12 UTSW 5 143245502 missense possibly damaging 0.85
R7188:Zfp12 UTSW 5 143239994 missense probably damaging 0.99
R7285:Zfp12 UTSW 5 143244689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGCAAGACGTTCTCTC -3'
(R):5'- TACGACATCCGAGAGAAGGC -3'

Sequencing Primer
(F):5'- GGGAAGTCCTTCTACCTGAACTCAG -3'
(R):5'- GACATCCGAGAGAAGGCTTTCC -3'
Posted On2014-10-16