Incidental Mutation 'R2281:Kdm3b'
ID243164
Institutional Source Beutler Lab
Gene Symbol Kdm3b
Ensembl Gene ENSMUSG00000038773
Gene NameKDM3B lysine (K)-specific demethylase 3B
SynonymsJHDM2B, Jmjd1b, 5830462I21Rik
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34777047-34838660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34808419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 521 (D521G)
Ref Sequence ENSEMBL: ENSMUSP00000037628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043775] [ENSMUST00000224715] [ENSMUST00000225195]
Predicted Effect probably damaging
Transcript: ENSMUST00000043775
AA Change: D521G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773
AA Change: D521G

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180512
Predicted Effect probably benign
Transcript: ENSMUST00000224715
Predicted Effect probably damaging
Transcript: ENSMUST00000225195
AA Change: D321G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225260
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Zfp532 T C 18: 65,624,712 V572A probably damaging Het
Other mutations in Kdm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kdm3b APN 18 34809409 missense probably benign 0.03
IGL01357:Kdm3b APN 18 34793014 missense probably damaging 1.00
IGL01615:Kdm3b APN 18 34829231 missense probably damaging 1.00
IGL01980:Kdm3b APN 18 34834236 missense probably damaging 1.00
IGL02277:Kdm3b APN 18 34823664 missense probably damaging 1.00
IGL02346:Kdm3b APN 18 34834238 missense probably damaging 1.00
IGL02417:Kdm3b APN 18 34808577 missense probably benign 0.03
IGL02531:Kdm3b APN 18 34795729 missense probably benign
IGL02589:Kdm3b APN 18 34812418 missense possibly damaging 0.89
IGL02793:Kdm3b APN 18 34829019 missense probably damaging 0.99
IGL03121:Kdm3b APN 18 34795709 missense probably damaging 0.98
IGL03123:Kdm3b APN 18 34809491 critical splice donor site probably null
IGL03128:Kdm3b APN 18 34827427 missense probably damaging 1.00
PIT4382001:Kdm3b UTSW 18 34809087 missense probably damaging 1.00
PIT4445001:Kdm3b UTSW 18 34793115 nonsense probably null
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0233:Kdm3b UTSW 18 34809420 missense probably damaging 0.97
R0265:Kdm3b UTSW 18 34795663 splice site probably benign
R0306:Kdm3b UTSW 18 34804017 missense probably benign 0.35
R0941:Kdm3b UTSW 18 34803552 missense probably damaging 0.99
R0970:Kdm3b UTSW 18 34809039 missense probably damaging 1.00
R1061:Kdm3b UTSW 18 34796862 missense probably damaging 1.00
R1104:Kdm3b UTSW 18 34819811 missense probably damaging 1.00
R1221:Kdm3b UTSW 18 34808245 missense possibly damaging 0.57
R1486:Kdm3b UTSW 18 34834304 missense probably damaging 1.00
R1523:Kdm3b UTSW 18 34793173 critical splice donor site probably null
R1558:Kdm3b UTSW 18 34809096 missense probably damaging 1.00
R1585:Kdm3b UTSW 18 34809292 missense probably damaging 1.00
R1601:Kdm3b UTSW 18 34808731 missense probably damaging 1.00
R1650:Kdm3b UTSW 18 34809115 missense possibly damaging 0.93
R1772:Kdm3b UTSW 18 34803504 missense probably benign 0.01
R1853:Kdm3b UTSW 18 34833393 missense probably damaging 1.00
R1934:Kdm3b UTSW 18 34813544 missense probably benign 0.04
R1959:Kdm3b UTSW 18 34812395 missense possibly damaging 0.55
R2079:Kdm3b UTSW 18 34803517 missense probably damaging 1.00
R2102:Kdm3b UTSW 18 34830147 missense probably damaging 1.00
R2121:Kdm3b UTSW 18 34796780 splice site probably benign
R3719:Kdm3b UTSW 18 34808671 missense probably damaging 1.00
R3755:Kdm3b UTSW 18 34808296 missense probably benign
R3857:Kdm3b UTSW 18 34833387 missense probably benign
R4165:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4166:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4372:Kdm3b UTSW 18 34827444 missense probably benign 0.00
R4672:Kdm3b UTSW 18 34808577 missense probably benign
R4933:Kdm3b UTSW 18 34810393 missense probably damaging 1.00
R4969:Kdm3b UTSW 18 34822375 missense probably damaging 1.00
R5009:Kdm3b UTSW 18 34824710 missense probably benign 0.42
R5059:Kdm3b UTSW 18 34777197 missense possibly damaging 0.83
R5092:Kdm3b UTSW 18 34813462 missense probably benign 0.16
R5270:Kdm3b UTSW 18 34827414 missense probably damaging 1.00
R5816:Kdm3b UTSW 18 34828469 missense probably damaging 0.99
R5970:Kdm3b UTSW 18 34829289 missense probably damaging 1.00
R6244:Kdm3b UTSW 18 34793005 missense probably damaging 1.00
R6705:Kdm3b UTSW 18 34819873 missense probably damaging 1.00
R6723:Kdm3b UTSW 18 34793005 missense probably damaging 0.99
R6909:Kdm3b UTSW 18 34827328 splice site probably null
R6958:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R7026:Kdm3b UTSW 18 34822464 missense possibly damaging 0.90
R7289:Kdm3b UTSW 18 34794504 missense probably benign 0.00
X0028:Kdm3b UTSW 18 34799266 intron probably null
X0067:Kdm3b UTSW 18 34823517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAATTCTAGTCTGGCCTCTTCTG -3'
(R):5'- TCTGCAGGCACTTTTCGGTC -3'

Sequencing Primer
(F):5'- CTGGATTTGGAGTGTCTCTCTCAAG -3'
(R):5'- CTGAGTATCTGCTCCGAGAACAG -3'
Posted On2014-10-16