Incidental Mutation 'R2281:Zfp532'
ID243166
Institutional Source Beutler Lab
Gene Symbol Zfp532
Ensembl Gene ENSMUSG00000042439
Gene Namezinc finger protein 532
SynonymsC530030I18Rik
MMRRC Submission 040280-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R2281 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location65580230-65689443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65624712 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 572 (V572A)
Ref Sequence ENSEMBL: ENSMUSP00000138663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049016] [ENSMUST00000169679] [ENSMUST00000182140] [ENSMUST00000182319] [ENSMUST00000182478] [ENSMUST00000182655] [ENSMUST00000182684] [ENSMUST00000182852] [ENSMUST00000182973] [ENSMUST00000182979] [ENSMUST00000183236] [ENSMUST00000183319] [ENSMUST00000183326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049016
AA Change: V572A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036582
Gene: ENSMUSG00000042439
AA Change: V572A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169679
AA Change: V572A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129390
Gene: ENSMUSG00000042439
AA Change: V572A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 784 807 1.25e-1 SMART
ZnF_C2H2 814 840 1.43e-1 SMART
low complexity region 860 872 N/A INTRINSIC
ZnF_C2H2 909 931 1.31e0 SMART
ZnF_C2H2 938 961 9.44e-2 SMART
ZnF_C2H2 999 1021 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182140
Predicted Effect probably benign
Transcript: ENSMUST00000182319
Predicted Effect possibly damaging
Transcript: ENSMUST00000182478
AA Change: V572A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138315
Gene: ENSMUSG00000042439
AA Change: V572A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182655
Predicted Effect probably benign
Transcript: ENSMUST00000182684
Predicted Effect probably damaging
Transcript: ENSMUST00000182852
AA Change: V572A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138663
Gene: ENSMUSG00000042439
AA Change: V572A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
ZnF_C2H2 780 802 4.34e0 SMART
ZnF_C2H2 808 832 1.55e1 SMART
ZnF_C2H2 839 862 8.94e-3 SMART
ZnF_C2H2 867 890 3.78e-1 SMART
ZnF_C2H2 902 924 7.15e-2 SMART
ZnF_C2H2 933 956 1.43e-1 SMART
ZnF_C2H2 1022 1045 4.72e-2 SMART
ZnF_C2H2 1052 1075 1.25e-1 SMART
ZnF_C2H2 1082 1108 1.43e-1 SMART
low complexity region 1128 1140 N/A INTRINSIC
ZnF_C2H2 1177 1199 1.31e0 SMART
ZnF_C2H2 1206 1229 9.44e-2 SMART
ZnF_C2H2 1267 1289 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182973
Predicted Effect possibly damaging
Transcript: ENSMUST00000182979
AA Change: V572A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138225
Gene: ENSMUSG00000042439
AA Change: V572A

DomainStartEndE-ValueType
low complexity region 253 287 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
low complexity region 395 417 N/A INTRINSIC
low complexity region 480 502 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
ZnF_C2H2 615 635 7.18e1 SMART
ZnF_C2H2 643 667 1.23e1 SMART
low complexity region 726 738 N/A INTRINSIC
ZnF_C2H2 751 772 4.57e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183184
Predicted Effect probably benign
Transcript: ENSMUST00000183236
Predicted Effect probably benign
Transcript: ENSMUST00000183319
Predicted Effect probably benign
Transcript: ENSMUST00000183326
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A G 3: 146,646,424 L228S probably damaging Het
Abca13 A T 11: 9,328,136 K3105N probably damaging Het
Abca3 T A 17: 24,376,726 L351Q possibly damaging Het
Acadm A G 3: 153,933,043 I231T possibly damaging Het
Adamts4 A T 1: 171,256,229 Q456L probably damaging Het
Adgra3 C T 5: 50,001,880 V343I probably benign Het
Ajuba C A 14: 54,577,188 G26V probably damaging Het
Aldh1a1 A G 19: 20,620,091 I145M possibly damaging Het
Ankrd42 G A 7: 92,625,773 Q110* probably null Het
Ano3 T A 2: 110,682,759 E630D probably benign Het
Ap3d1 T C 10: 80,713,998 D771G probably damaging Het
Arhgap30 A G 1: 171,389,328 D21G probably damaging Het
Atg13 T C 2: 91,679,425 N374S probably benign Het
Ccser1 A T 6: 61,570,815 M49L probably damaging Het
Cdh5 A G 8: 104,125,733 E160G probably damaging Het
Cpd T C 11: 76,797,801 K882E probably benign Het
Crtac1 G A 19: 42,283,567 L646F unknown Het
Cyp27b1 T G 10: 127,048,294 V5G probably damaging Het
Dcaf11 G T 14: 55,569,371 *550Y probably null Het
Dhx58 A G 11: 100,698,154 probably null Het
Dlg2 T A 7: 92,438,041 I881N probably damaging Het
Ece1 C T 4: 137,946,362 T407M possibly damaging Het
Ecsit C T 9: 22,076,540 V68I possibly damaging Het
Egln1 T C 8: 124,948,414 D214G probably benign Het
Espn T C 4: 152,135,545 T47A possibly damaging Het
F5 A G 1: 164,195,720 I1616V possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fryl T C 5: 73,041,364 D2640G possibly damaging Het
Gabrg2 T C 11: 41,976,636 K52R possibly damaging Het
Ganab T C 19: 8,909,468 V306A probably damaging Het
Glod4 A T 11: 76,237,809 I70N possibly damaging Het
Gm8251 T A 1: 44,056,460 H1826L possibly damaging Het
Gsn T A 2: 35,283,918 V2E probably benign Het
Hist1h1c A G 13: 23,738,924 K26E probably benign Het
Hrg C T 16: 22,961,309 probably benign Het
Kctd19 T C 8: 105,387,266 T592A probably benign Het
Kdm3b A G 18: 34,808,419 D521G probably damaging Het
Lrba A G 3: 86,776,103 H2744R possibly damaging Het
Lsr C T 7: 30,958,345 A397T probably damaging Het
Methig1 A T 15: 100,353,360 M51L possibly damaging Het
Mga A G 2: 119,903,723 I351V probably benign Het
Mlf1 G A 3: 67,399,751 V250I possibly damaging Het
Mreg A T 1: 72,192,064 N78K probably damaging Het
Mtor A G 4: 148,489,555 D1294G probably benign Het
Nfkb1 T C 3: 135,601,521 I548V probably damaging Het
Nlrp3 T C 11: 59,549,136 F513S possibly damaging Het
Nphp4 A G 4: 152,557,043 K1094E possibly damaging Het
Nr3c2 C A 8: 76,909,907 H546N probably damaging Het
Nr4a2 T A 2: 57,112,199 M18L probably benign Het
Olfr1214 G A 2: 88,987,470 T244I probably benign Het
Olfr1392 A C 11: 49,293,632 T104P probably benign Het
Pclo A G 5: 14,540,332 N882S unknown Het
Pde6a T C 18: 61,262,434 Y583H probably damaging Het
Pip5k1b T A 19: 24,378,947 Y209F probably damaging Het
Plch2 A T 4: 154,984,309 S1182T probably damaging Het
Ptger2 G T 14: 44,989,650 R229L probably damaging Het
Ptpru C A 4: 131,808,499 G389V probably damaging Het
Ric8a A G 7: 140,861,938 N249S probably benign Het
Slc26a5 A G 5: 21,831,510 I266T possibly damaging Het
Smyd1 T C 6: 71,238,676 N100D probably damaging Het
Stag3 T C 5: 138,298,284 F468S probably damaging Het
Stk31 C T 6: 49,417,250 T182I probably damaging Het
Svep1 G T 4: 58,082,677 N1982K possibly damaging Het
Thegl T C 5: 77,059,367 I324T probably damaging Het
Tinagl1 A G 4: 130,166,993 Y344H probably damaging Het
Tmem216 T A 19: 10,551,873 T104S probably damaging Het
Tmem231 T C 8: 111,918,931 D112G probably damaging Het
Ube4b A G 4: 149,344,572 I870T probably damaging Het
Vwa8 T A 14: 79,064,996 L1035Q possibly damaging Het
Wdr35 A G 12: 8,978,628 Q82R probably benign Het
Wnk1 A T 6: 119,963,640 probably null Het
Zc3h7a T C 16: 11,158,594 probably benign Het
Other mutations in Zfp532
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Zfp532 APN 18 65624778 missense probably damaging 1.00
IGL02451:Zfp532 APN 18 65623601 missense probably damaging 0.96
IGL02496:Zfp532 APN 18 65624042 missense probably damaging 1.00
PIT4151001:Zfp532 UTSW 18 65624414 missense probably damaging 1.00
R0048:Zfp532 UTSW 18 65644333 missense probably damaging 1.00
R0076:Zfp532 UTSW 18 65685627 missense probably benign 0.07
R0095:Zfp532 UTSW 18 65624784 missense probably damaging 1.00
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0239:Zfp532 UTSW 18 65682985 missense possibly damaging 0.63
R0539:Zfp532 UTSW 18 65623766 missense probably benign 0.04
R0948:Zfp532 UTSW 18 65623818 missense probably damaging 1.00
R1447:Zfp532 UTSW 18 65624990 missense probably damaging 1.00
R1645:Zfp532 UTSW 18 65687264 missense probably benign 0.26
R1749:Zfp532 UTSW 18 65623484 missense possibly damaging 0.83
R1797:Zfp532 UTSW 18 65625144 missense probably benign 0.04
R1934:Zfp532 UTSW 18 65685611 missense probably damaging 0.97
R1959:Zfp532 UTSW 18 65624492 missense probably damaging 0.99
R2153:Zfp532 UTSW 18 65624927 missense possibly damaging 0.93
R2280:Zfp532 UTSW 18 65624712 missense probably damaging 0.96
R2847:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R2848:Zfp532 UTSW 18 65656626 missense possibly damaging 0.79
R4483:Zfp532 UTSW 18 65656565 missense probably benign 0.02
R4938:Zfp532 UTSW 18 65623766 missense probably benign
R4947:Zfp532 UTSW 18 65625066 missense possibly damaging 0.46
R5714:Zfp532 UTSW 18 65623535 missense possibly damaging 0.93
R5920:Zfp532 UTSW 18 65644350 missense probably benign
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6035:Zfp532 UTSW 18 65623934 missense possibly damaging 0.95
R6092:Zfp532 UTSW 18 65644210 missense probably damaging 1.00
R6170:Zfp532 UTSW 18 65624438 missense probably damaging 0.97
R6180:Zfp532 UTSW 18 65656471 missense probably benign
R6889:Zfp532 UTSW 18 65686990 missense possibly damaging 0.66
R7039:Zfp532 UTSW 18 65638763 missense probably benign 0.44
R7095:Zfp532 UTSW 18 65682898 missense probably benign
R7313:Zfp532 UTSW 18 65623005 missense probably damaging 1.00
R7400:Zfp532 UTSW 18 65638913 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CAAACTCGTGCCAAAGACTG -3'
(R):5'- AGTGGTTGCACGTCACTTC -3'

Sequencing Primer
(F):5'- TGCCAAAGACTGTGCACCTTG -3'
(R):5'- GGTTGCACGTCACTTCGATGC -3'
Posted On2014-10-16