Incidental Mutation 'R2283:Fas'
ID243230
Institutional Source Beutler Lab
Gene Symbol Fas
Ensembl Gene ENSMUSG00000024778
Gene NameFas (TNF receptor superfamily member 6)
SynonymsAPO-1, CD95, TNFR6, Tnfrsf6
MMRRC Submission 040282-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2283 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34290659-34327770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34307249 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 52 (G52D)
Ref Sequence ENSEMBL: ENSMUSP00000108091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025691] [ENSMUST00000112472]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025691
AA Change: G52D

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778
AA Change: G52D

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112472
AA Change: G52D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108091
Gene: ENSMUSG00000024778
AA Change: G52D

DomainStartEndE-ValueType
Blast:TNFR 44 61 5e-6 BLAST
SCOP:d1jmab1 44 61 1e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,377,891 E1235G probably damaging Het
Anapc1 A T 2: 128,642,548 H1165Q probably benign Het
Bhmt G A 13: 93,620,301 P273L probably damaging Het
Clec18a A G 8: 111,075,508 V283A probably benign Het
Dlg5 G A 14: 24,158,663 P825L probably benign Het
Fras1 T C 5: 96,654,305 I1209T probably benign Het
Gpt2 T A 8: 85,516,189 D283E probably benign Het
Hrh1 C T 6: 114,480,439 T227I probably benign Het
Kif26a T C 12: 112,177,353 F1347S possibly damaging Het
Krt2 T C 15: 101,814,387 Y392C probably damaging Het
Masp2 A G 4: 148,606,068 K261E probably benign Het
Nav2 G T 7: 49,491,404 R899L probably damaging Het
Nuggc T C 14: 65,638,612 V574A possibly damaging Het
Olfr11 G A 13: 21,639,020 R168C probably damaging Het
Pcsk4 T C 10: 80,322,750 E556G probably damaging Het
Ppa1 G A 10: 61,661,009 W92* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sp3 A C 2: 72,971,177 I164S possibly damaging Het
St8sia3 G T 18: 64,271,730 E359D probably damaging Het
Usp17lb A G 7: 104,840,652 I355T possibly damaging Het
Zfp608 T A 18: 54,988,374 K47I probably damaging Het
Zfp931 A G 2: 178,069,921 V11A possibly damaging Het
Other mutations in Fas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34318618 missense probably damaging 1.00
IGL01677:Fas APN 19 34318818 missense probably benign 0.09
IGL01834:Fas APN 19 34318603 missense probably benign 0.33
IGL02130:Fas APN 19 34315295 missense probably benign 0.01
IGL02424:Fas APN 19 34327034 missense probably damaging 1.00
IGL02532:Fas APN 19 34316599 missense probably damaging 0.99
IGL02569:Fas APN 19 34320562 missense possibly damaging 0.93
bing UTSW 19 34316569 missense probably damaging 1.00
cherry UTSW 19 34327140 missense probably damaging 0.99
P0021:Fas UTSW 19 34307210 missense probably damaging 0.98
R0525:Fas UTSW 19 34319327 missense probably damaging 1.00
R0588:Fas UTSW 19 34327140 missense probably damaging 0.99
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R2077:Fas UTSW 19 34320553 splice site probably benign
R4154:Fas UTSW 19 34318828 missense possibly damaging 0.72
R5252:Fas UTSW 19 34316643 missense probably damaging 0.99
R5943:Fas UTSW 19 34320587 critical splice donor site probably null
R6474:Fas UTSW 19 34316569 missense probably damaging 1.00
R6837:Fas UTSW 19 34307164 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGTTGCTTGGTTCAGAAATCAC -3'
(R):5'- TCTTTTAGAAGCAGCCCAGAC -3'

Sequencing Primer
(F):5'- GCTTGGTTCAGAAATCACTAACATCC -3'
(R):5'- TTTAGAAGCAGCCCAGACAAATATG -3'
Posted On2014-10-16