Incidental Mutation 'R2284:Mslnl'
ID243267
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission 040283-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R2284 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25742934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq C T 16: 23,157,487 Q213* probably null Het
Adsl C T 15: 80,963,895 P278L probably damaging Het
Bcas2 T C 3: 103,178,362 S187P probably damaging Het
Ccdc36 C T 9: 108,421,473 E49K probably damaging Het
Ccdc88a T C 11: 29,494,099 probably null Het
Cryzl1 C T 16: 91,694,305 probably benign Het
Csl T A 10: 99,758,459 D248V possibly damaging Het
Dip2a A C 10: 76,313,193 V247G probably benign Het
Fat2 T C 11: 55,282,360 D2509G probably damaging Het
Gldn G A 9: 54,286,565 W14* probably null Het
Gm5698 C T 1: 30,977,883 R29Q possibly damaging Het
Gm5830 A T 1: 78,967,698 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,183 D761G probably benign Het
Hdac10 T C 15: 89,127,404 Q159R probably benign Het
Hhatl T C 9: 121,789,582 Y118C probably damaging Het
Klrd1 A G 6: 129,598,381 H127R probably benign Het
Krtap31-1 C T 11: 99,908,255 Q95* probably null Het
Map2 C T 1: 66,414,068 P548S probably damaging Het
Mki67 A G 7: 135,699,945 V1120A probably damaging Het
Mtmr12 T A 15: 12,245,011 M204K probably damaging Het
Muc6 T C 7: 141,637,924 T2279A possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nlrp1b A G 11: 71,156,284 S1084P probably benign Het
Nr2f1 C A 13: 78,195,462 V81F probably damaging Het
Nrxn3 T A 12: 89,510,365 N803K probably damaging Het
Olfr1157 A G 2: 87,962,793 L33P probably damaging Het
Ptpre A G 7: 135,669,781 H375R probably benign Het
Tsc1 G A 2: 28,665,097 V200I possibly damaging Het
Vmn1r42 A G 6: 89,844,699 I296T probably benign Het
Vmn1r67 A T 7: 10,447,673 H288L probably damaging Het
Vmn2r45 A T 7: 8,485,766 N88K probably benign Het
Wt1 A G 2: 105,172,321 T511A probably benign Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGCCATCAGAAGGGAGGTTTG -3'
(R):5'- AGAAGCCACAGGTCTGAAGC -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- CCACAGGTCTGAAGCACTGAG -3'
Posted On2014-10-16