Incidental Mutation 'R2286:Alox5ap'
ID243299
Institutional Source Beutler Lab
Gene Symbol Alox5ap
Ensembl Gene ENSMUSG00000060063
Gene Namearachidonate 5-lipoxygenase activating protein
Synonymsarachidonate 5 lipoxygenase activating protein, Flap
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location149264767-149288153 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 149285430 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071130] [ENSMUST00000200806] [ENSMUST00000200928]
Predicted Effect probably null
Transcript: ENSMUST00000071130
SMART Domains Protein: ENSMUSP00000071130
Gene: ENSMUSG00000060063

DomainStartEndE-ValueType
Pfam:MAPEG 5 133 7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082770
Predicted Effect probably null
Transcript: ENSMUST00000200806
SMART Domains Protein: ENSMUSP00000144472
Gene: ENSMUSG00000060063

DomainStartEndE-ValueType
PDB:2Q7R|F 1 70 9e-41 PDB
Predicted Effect probably null
Transcript: ENSMUST00000200928
SMART Domains Protein: ENSMUSP00000144115
Gene: ENSMUSG00000060063

DomainStartEndE-ValueType
PDB:2Q7R|F 1 73 5e-43 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202629
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which, with 5-lipoxygenase, is required for leukotriene synthesis. Leukotrienes are arachidonic acid metabolites which have been implicated in various types of inflammatory responses, including asthma, arthritis and psoriasis. This protein localizes to the plasma membrane. Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit 5-lipoxygenase activation. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Targeted mutations of this gene result in a complete defect in leukotriene production, resistance to platelet-activating factor mediated anaphylaxis, and reduced acute and chronic inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Alox5ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0042:Alox5ap UTSW 5 149279259 intron probably benign
R1537:Alox5ap UTSW 5 149265183 unclassified probably null
R6861:Alox5ap UTSW 5 149265117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAGACACTAATGGCTTAACC -3'
(R):5'- CTAGGAATCAAGGCTGTGCG -3'

Sequencing Primer
(F):5'- CCACTGGTACTGTTGTGTGAACAAC -3'
(R):5'- GCTGTGCGAAGGAAAAATTTAAC -3'
Posted On2014-10-16