Incidental Mutation 'R2286:Ap2s1'
ID243301
Institutional Source Beutler Lab
Gene Symbol Ap2s1
Ensembl Gene ENSMUSG00000008036
Gene Nameadaptor-related protein complex 2, sigma 1 subunit
Synonyms
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16738410-16749294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16748976 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000083281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086112] [ENSMUST00000205590] [ENSMUST00000205607]
PDB Structure
AP2 CLATHRIN ADAPTOR CORE with Dileucine peptide RM(phosphoS)QIKRLLSE [X-RAY DIFFRACTION]
AP2 CLATHRIN ADAPTOR CORE with CD4 Dileucine peptide RM(phosphoS) EIKRLLSE Q to E mutant [X-RAY DIFFRACTION]
AP2 CLATHRIN ADAPTOR CORE [X-RAY DIFFRACTION]
AP2 CLATHRIN ADAPTOR CORE IN ACTIVE COMPLEX WITH CARGO PEPTIDES [X-RAY DIFFRACTION]
AP2 controls clathrin polymerization with a membrane-activated switch [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086112
AA Change: V131A

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083281
Gene: ENSMUSG00000008036
AA Change: V131A

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 2.9e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141496
Predicted Effect probably benign
Transcript: ENSMUST00000205590
Predicted Effect possibly damaging
Transcript: ENSMUST00000205607
AA Change: V81A

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205673
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] One of two major clathrin-associated adaptor complexes, AP-2, is a heterotetramer which is associated with the plasma membrane. This complex is composed of two large chains, a medium chain, and a small chain. This gene encodes the small chain of this complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Ap2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0277:Ap2s1 UTSW 7 16747380 splice site probably benign
R0416:Ap2s1 UTSW 7 16747365 missense probably damaging 1.00
R4843:Ap2s1 UTSW 7 16743346 missense possibly damaging 0.79
R5135:Ap2s1 UTSW 7 16747323 missense probably damaging 1.00
R6828:Ap2s1 UTSW 7 16748701 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCACCAAAGATCTGCCTG -3'
(R):5'- TTACTCGGGACATCACGGTG -3'

Sequencing Primer
(F):5'- AAAGATCTGCCTGCCCCTG -3'
(R):5'- ACATCACGGTGGCCTCTG -3'
Posted On2014-10-16