Incidental Mutation 'R2286:Vps26c'
ID 243313
Institutional Source Beutler Lab
Gene Symbol Vps26c
Ensembl Gene ENSMUSG00000022898
Gene Name VPS26 endosomal protein sorting factor C
Synonyms Dscr3, Down syndrome critical region gene 3, Dcra
MMRRC Submission 040285-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R2286 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 94298583-94327488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 94313112 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 60 (E60K)
Ref Sequence ENSEMBL: ENSMUSP00000156097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023615] [ENSMUST00000125229]
AlphaFold O35075
Predicted Effect possibly damaging
Transcript: ENSMUST00000023615
AA Change: E60K

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023615
Gene: ENSMUSG00000022898
AA Change: E60K

DomainStartEndE-ValueType
Pfam:Vps26 3 283 2.5e-79 PFAM
Pfam:Arrestin_N 5 144 9.7e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125229
AA Change: E60K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210205
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The region of chromosome 21 between genes CBR and ERG (CBR-ERG region), which spans 2.5 Mb on 21q22.2, has been defined by analysis of patients with partial trisomy 21. It contributes significantly to the pathogenesis of many characteristics of Down syndrome, including morphological features, hypotonia, and mental retardation. The DSCR3 (Down syndrome critical region gene 3) gene is found in this region and is predictated to contain eight exons. DSCR3 is expressed in most tissues examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,195,616 (GRCm39) R308H probably damaging Het
Alox5ap G A 5: 149,222,240 (GRCm39) probably null Het
Ap2s1 T C 7: 16,482,901 (GRCm39) V131A possibly damaging Het
Cdr2l GAA GA 11: 115,283,626 (GRCm39) probably null Het
Cpsf7 T C 19: 10,512,660 (GRCm39) L248P probably damaging Het
Dtd1 T C 2: 144,477,786 (GRCm39) probably null Het
Eci1 A G 17: 24,652,203 (GRCm39) D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,151,791 (GRCm39) probably benign Het
Luc7l A G 17: 26,499,020 (GRCm39) probably benign Het
Med13 A C 11: 86,210,515 (GRCm39) D542E probably benign Het
Myo6 T C 9: 80,173,494 (GRCm39) S545P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Or4k37 A G 2: 111,159,252 (GRCm39) I163V probably benign Het
Rsad2 T A 12: 26,500,675 (GRCm39) N204I probably benign Het
Setd5 T G 6: 113,096,571 (GRCm39) N592K possibly damaging Het
Sgip1 G T 4: 102,724,844 (GRCm39) S59I possibly damaging Het
Slc39a5 A G 10: 128,231,929 (GRCm39) V532A probably benign Het
Smarcc2 G A 10: 128,299,612 (GRCm39) M123I possibly damaging Het
Tdrd1 A G 19: 56,827,551 (GRCm39) T185A probably benign Het
Tnn T C 1: 159,938,079 (GRCm39) E1146G possibly damaging Het
Unc13a T C 8: 72,083,203 (GRCm39) K1618E probably damaging Het
Vmn2r120 A G 17: 57,815,958 (GRCm39) L799P probably damaging Het
Other mutations in Vps26c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:Vps26c APN 16 94,302,549 (GRCm39) splice site probably benign
R0644:Vps26c UTSW 16 94,303,054 (GRCm39) missense probably damaging 1.00
R1256:Vps26c UTSW 16 94,313,225 (GRCm39) missense probably damaging 1.00
R1973:Vps26c UTSW 16 94,302,405 (GRCm39) missense probably damaging 0.99
R3854:Vps26c UTSW 16 94,311,665 (GRCm39) missense probably benign 0.01
R3855:Vps26c UTSW 16 94,311,665 (GRCm39) missense probably benign 0.01
R5067:Vps26c UTSW 16 94,327,263 (GRCm39) unclassified probably benign
R7578:Vps26c UTSW 16 94,299,928 (GRCm39) missense probably damaging 0.99
R7956:Vps26c UTSW 16 94,302,505 (GRCm39) missense probably damaging 1.00
R8944:Vps26c UTSW 16 94,302,481 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAAGCTCGGATGACTCAAGTC -3'
(R):5'- CAGAAAGGTGTGCTGCTCTG -3'

Sequencing Primer
(F):5'- GCACCAGCCAGGGATATTAC -3'
(R):5'- GCTGCTCTGATTGGAGGC -3'
Posted On 2014-10-16