Incidental Mutation 'R2256:Fat1'
ID243386
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene NameFAT atypical cadherin 1
SynonymsmFat1, Fath, 2310038E12Rik
MMRRC Submission 040256-MU
Accession Numbers

Genbank: NM_001081286

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2256 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location44935447-45052257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44950371 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 53 (Y53C)
Ref Sequence ENSEMBL: ENSMUSP00000149194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
Predicted Effect probably damaging
Transcript: ENSMUST00000098796
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: Y53C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189017
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000191428
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: Y53C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215588
AA Change: Y53C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
6720489N17Rik A T 13: 62,607,396 I36N probably benign Het
Abcb4 T C 5: 8,958,431 S1200P probably damaging Het
Acadsb A G 7: 131,443,653 Y438C probably benign Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Actr3b A G 5: 25,822,405 T113A possibly damaging Het
Adgrv1 T C 13: 81,506,140 D2204G probably benign Het
Ago1 A G 4: 126,441,911 V669A possibly damaging Het
Ang5 T A 14: 43,962,521 L14Q probably null Het
Aoc1 T C 6: 48,906,440 Y417H possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atf2 A T 2: 73,845,511 probably null Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Bend5 A C 4: 111,431,010 probably benign Het
Camkk2 T C 5: 122,746,335 D341G probably damaging Het
Cast T A 13: 74,739,905 I208L probably damaging Het
Ccdc141 A T 2: 77,132,262 W113R probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cel A G 2: 28,561,192 F51S probably damaging Het
Cenpc1 A G 5: 86,016,203 L853S probably damaging Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Cntnap5c T A 17: 58,330,315 N1062K probably benign Het
Col3a1 A G 1: 45,321,632 D74G unknown Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cox6a1 C T 5: 115,348,848 E35K possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Ddx46 A G 13: 55,647,708 K177E possibly damaging Het
Dmbt1 T C 7: 131,090,494 F823L probably benign Het
Drc7 A T 8: 95,075,009 H666L probably benign Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam71e2 T A 7: 4,771,021 M31L probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fhdc1 T C 3: 84,446,046 E624G probably benign Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Fsip2 T A 2: 82,962,751 D417E probably benign Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Gtf2b A G 3: 142,781,424 D207G probably benign Het
Has3 C A 8: 106,874,256 L117I probably damaging Het
Jmjd1c T A 10: 67,225,294 I1142N probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mast4 A T 13: 102,735,751 C2178S possibly damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mphosph9 C T 5: 124,283,659 V740I probably benign Het
Mut A T 17: 40,956,319 I595F probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nlrc4 A G 17: 74,445,630 I586T probably damaging Het
Nom1 T A 5: 29,437,752 V417D probably damaging Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr1000 T A 2: 85,608,463 Y149F possibly damaging Het
Olfr1254 T C 2: 89,788,470 H294R probably benign Het
Olfr1290 T C 2: 111,489,978 Y60C probably damaging Het
Olfr474 A T 7: 107,955,037 Y132F probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Orai2 C T 5: 136,161,600 V52I probably damaging Het
Osbpl5 A G 7: 143,709,094 C186R probably damaging Het
Osbpl6 A G 2: 76,584,474 E403G probably damaging Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Parm1 C T 5: 91,594,121 T116I possibly damaging Het
Pde4dip T A 3: 97,718,184 Q1366L probably damaging Het
Phgdh T C 3: 98,328,291 K108E probably benign Het
Pold1 T C 7: 44,533,799 probably null Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Sdk2 T C 11: 113,830,794 N1332S probably benign Het
Sema6d A G 2: 124,664,150 D626G probably damaging Het
Skiv2l2 A T 13: 112,876,512 M890K probably damaging Het
Slc18b1 A G 10: 23,810,922 N212S probably benign Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Sntg2 C T 12: 30,236,688 W302* probably null Het
Spata22 T A 11: 73,340,475 M185K possibly damaging Het
Stk35 T A 2: 129,810,507 Y309* probably null Het
Taar8c A G 10: 24,101,071 V281A probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmtc4 A T 14: 122,941,408 I449N probably benign Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Tmub1 G A 5: 24,447,177 probably benign Het
Tshz2 A G 2: 169,886,477 T529A probably damaging Het
Ugdh A T 5: 65,417,115 probably benign Het
Usp25 A G 16: 77,113,794 K913E probably benign Het
Vgf A G 5: 137,031,547 probably benign Het
Vmn2r19 T A 6: 123,329,886 F451Y probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps9d1 C A 8: 123,245,121 A582S probably benign Het
Xbp1 T G 11: 5,524,841 H247Q probably damaging Het
Zfp319 A T 8: 95,328,501 M358K possibly damaging Het
Zfp438 A T 18: 5,213,508 N483K probably damaging Het
Zfp518b T C 5: 38,671,636 N1009D possibly damaging Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Zgrf1 T A 3: 127,561,997 S291T probably benign Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45024602 missense possibly damaging 0.93
IGL00157:Fat1 APN 8 44951670 missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45050940 missense probably benign 0.18
IGL00983:Fat1 APN 8 45033390 missense probably damaging 1.00
IGL01089:Fat1 APN 8 45017857 missense probably damaging 1.00
IGL01135:Fat1 APN 8 45024840 missense probably damaging 1.00
IGL01143:Fat1 APN 8 45035532 missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45023949 missense probably damaging 1.00
IGL01376:Fat1 APN 8 45026841 missense probably benign 0.00
IGL01411:Fat1 APN 8 45026800 missense probably damaging 1.00
IGL01443:Fat1 APN 8 45040576 missense probably damaging 1.00
IGL01453:Fat1 APN 8 45051270 missense probably damaging 1.00
IGL01606:Fat1 APN 8 45023049 missense probably benign 0.26
IGL01622:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45040700 missense probably benign 0.05
IGL01735:Fat1 APN 8 45036239 missense probably benign 0.07
IGL01793:Fat1 APN 8 44989112 missense probably benign
IGL01820:Fat1 APN 8 45010502 missense probably damaging 1.00
IGL01969:Fat1 APN 8 44952599 missense probably damaging 0.98
IGL02012:Fat1 APN 8 45027540 missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45023659 missense probably damaging 1.00
IGL02256:Fat1 APN 8 44950332 missense probably damaging 1.00
IGL02273:Fat1 APN 8 44950331 missense probably damaging 1.00
IGL02317:Fat1 APN 8 45025818 missense probably benign 0.33
IGL02324:Fat1 APN 8 45040556 missense probably damaging 1.00
IGL02336:Fat1 APN 8 44951583 missense probably benign 0.16
IGL02442:Fat1 APN 8 44950323 missense probably benign 0.02
IGL02486:Fat1 APN 8 45025072 missense probably benign 0.16
IGL02551:Fat1 APN 8 45051398 missense probably damaging 1.00
IGL02617:Fat1 APN 8 45035591 missense probably benign 0.31
IGL02698:Fat1 APN 8 45023164 missense probably benign
IGL02885:Fat1 APN 8 44989167 missense probably benign 0.01
IGL02904:Fat1 APN 8 45040682 missense probably damaging 1.00
IGL02953:Fat1 APN 8 45024314 missense probably damaging 1.00
IGL03108:Fat1 APN 8 45023614 missense probably damaging 1.00
IGL03153:Fat1 APN 8 45030123 missense possibly damaging 0.83
IGL03183:Fat1 APN 8 44950586 missense probably damaging 0.99
IGL03327:Fat1 APN 8 44950468 missense probably damaging 1.00
IGL03405:Fat1 APN 8 45025241 missense probably damaging 1.00
laggardly UTSW 8 45044464 missense probably damaging 1.00
shrinkage UTSW 8 45018037 missense probably damaging 1.00
F5493:Fat1 UTSW 8 45025480 missense probably damaging 0.99
I2289:Fat1 UTSW 8 45024996 missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45017434 missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45029540 missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45037207 missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45024645 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0078:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R0197:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0328:Fat1 UTSW 8 45023790 missense probably benign 0.35
R0367:Fat1 UTSW 8 45024313 missense probably damaging 1.00
R0371:Fat1 UTSW 8 44951892 missense probably damaging 1.00
R0380:Fat1 UTSW 8 45010123 missense probably damaging 0.97
R0389:Fat1 UTSW 8 44950348 missense probably benign 0.00
R0433:Fat1 UTSW 8 45024649 missense possibly damaging 0.51
R0456:Fat1 UTSW 8 45029534 missense probably damaging 1.00
R0494:Fat1 UTSW 8 44950542 missense probably damaging 1.00
R0506:Fat1 UTSW 8 45022951 missense probably damaging 0.99
R0512:Fat1 UTSW 8 44951332 nonsense probably null
R0624:Fat1 UTSW 8 45051168 missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0723:Fat1 UTSW 8 45026749 missense probably damaging 1.00
R0787:Fat1 UTSW 8 45040555 missense probably damaging 1.00
R0788:Fat1 UTSW 8 45023983 missense probably benign 0.27
R0862:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0864:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0907:Fat1 UTSW 8 45026598 missense probably benign 0.08
R0962:Fat1 UTSW 8 45033326 splice site probably benign
R1051:Fat1 UTSW 8 45044506 missense probably damaging 1.00
R1156:Fat1 UTSW 8 45039890 missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45044279 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1478:Fat1 UTSW 8 45025622 missense probably damaging 0.99
R1482:Fat1 UTSW 8 44953244 missense probably benign 0.04
R1496:Fat1 UTSW 8 45033390 missense probably damaging 1.00
R1498:Fat1 UTSW 8 45025484 nonsense probably null
R1508:Fat1 UTSW 8 45026862 missense probably benign 0.01
R1577:Fat1 UTSW 8 45023383 missense probably benign 0.30
R1646:Fat1 UTSW 8 45018042 missense probably damaging 1.00
R1652:Fat1 UTSW 8 45025178 nonsense probably null
R1656:Fat1 UTSW 8 45025530 nonsense probably null
R1662:Fat1 UTSW 8 44953164 missense probably benign 0.20
R1672:Fat1 UTSW 8 45036835 missense probably damaging 1.00
R1704:Fat1 UTSW 8 45025576 missense probably damaging 1.00
R1708:Fat1 UTSW 8 45024792 missense probably damaging 1.00
R1710:Fat1 UTSW 8 45010482 missense probably benign 0.00
R1812:Fat1 UTSW 8 45036803 missense probably damaging 1.00
R1872:Fat1 UTSW 8 44953304 missense probably benign 0.01
R1872:Fat1 UTSW 8 45038349 missense probably damaging 1.00
R1883:Fat1 UTSW 8 45051147 missense probably benign 0.17
R1893:Fat1 UTSW 8 45023856 missense probably damaging 1.00
R1930:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45033926 missense probably benign 0.00
R1957:Fat1 UTSW 8 45040682 missense probably damaging 1.00
R1999:Fat1 UTSW 8 44952393 missense probably damaging 0.96
R2019:Fat1 UTSW 8 45023746 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45024332 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45026704 missense probably damaging 1.00
R2117:Fat1 UTSW 8 45037463 missense probably benign 0.33
R2196:Fat1 UTSW 8 45024646 missense probably damaging 1.00
R2204:Fat1 UTSW 8 45023700 missense probably damaging 1.00
R2257:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2409:Fat1 UTSW 8 45040530 splice site probably benign
R2416:Fat1 UTSW 8 45026383 missense probably damaging 1.00
R3021:Fat1 UTSW 8 45044011 missense probably damaging 1.00
R3108:Fat1 UTSW 8 45045173 splice site probably null
R3109:Fat1 UTSW 8 45045173 splice site probably null
R3196:Fat1 UTSW 8 44951868 missense probably benign 0.00
R3683:Fat1 UTSW 8 45017938 missense probably benign
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3733:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45025479 missense probably damaging 0.97
R3905:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3907:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3908:Fat1 UTSW 8 45023035 missense probably benign 0.00
R4060:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4061:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4062:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4063:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4078:Fat1 UTSW 8 44989122 missense probably damaging 0.99
R4105:Fat1 UTSW 8 45036851 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45010437 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45050944 missense probably damaging 1.00
R4161:Fat1 UTSW 8 45036787 missense probably benign 0.00
R4364:Fat1 UTSW 8 44952962 missense probably benign 0.01
R4394:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4395:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4396:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4412:Fat1 UTSW 8 45023599 missense probably damaging 0.99
R4542:Fat1 UTSW 8 45041894 missense probably damaging 1.00
R4591:Fat1 UTSW 8 45026242 missense probably benign
R4606:Fat1 UTSW 8 44950683 missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45025147 missense probably damaging 1.00
R4730:Fat1 UTSW 8 45033477 missense probably damaging 1.00
R4778:Fat1 UTSW 8 45038326 missense probably benign 0.04
R4824:Fat1 UTSW 8 44989114 missense probably damaging 1.00
R4829:Fat1 UTSW 8 45036162 missense probably damaging 1.00
R4832:Fat1 UTSW 8 45013065 missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45012970 missense probably benign 0.15
R4896:Fat1 UTSW 8 44951280 missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45022963 missense probably damaging 0.96
R4941:Fat1 UTSW 8 45036275 missense probably benign 0.00
R5011:Fat1 UTSW 8 45031263 critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45023380 missense probably damaging 1.00
R5112:Fat1 UTSW 8 45024282 missense probably damaging 1.00
R5151:Fat1 UTSW 8 44951814 missense possibly damaging 0.74
R5161:Fat1 UTSW 8 44952512 missense probably benign 0.00
R5162:Fat1 UTSW 8 45025809 missense probably benign 0.02
R5353:Fat1 UTSW 8 45036131 missense probably benign 0.13
R5425:Fat1 UTSW 8 45025885 missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45013053 missense probably damaging 1.00
R5479:Fat1 UTSW 8 45036875 missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45023479 missense probably damaging 0.99
R5569:Fat1 UTSW 8 45039836 missense probably damaging 0.98
R5610:Fat1 UTSW 8 44953072 nonsense probably null
R5734:Fat1 UTSW 8 45051209 missense probably damaging 0.99
R5832:Fat1 UTSW 8 45017423 missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45051129 missense probably benign
R5886:Fat1 UTSW 8 45027681 critical splice donor site probably null
R5886:Fat1 UTSW 8 45033395 missense probably damaging 1.00
R5919:Fat1 UTSW 8 45026873 critical splice donor site probably null
R5930:Fat1 UTSW 8 45044036 missense probably benign 0.10
R5960:Fat1 UTSW 8 45033368 missense probably damaging 1.00
R5988:Fat1 UTSW 8 45029456 missense probably benign 0.00
R6166:Fat1 UTSW 8 44952485 missense probably damaging 1.00
R6184:Fat1 UTSW 8 44953392 missense probably benign 0.00
R6208:Fat1 UTSW 8 45027613 missense probably damaging 0.99
R6351:Fat1 UTSW 8 45033495 missense probably damaging 1.00
R6391:Fat1 UTSW 8 44952342 missense possibly damaging 0.69
R6701:Fat1 UTSW 8 44950681 missense probably damaging 1.00
R6702:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6703:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6704:Fat1 UTSW 8 45024373 missense probably damaging 1.00
R6822:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R6852:Fat1 UTSW 8 45035598 missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45044464 missense probably damaging 1.00
R6885:Fat1 UTSW 8 44952452 missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45051023 missense probably benign 0.00
R6927:Fat1 UTSW 8 45024495 missense probably benign 0.41
R6964:Fat1 UTSW 8 45043945 missense probably damaging 1.00
R7010:Fat1 UTSW 8 44953349 nonsense probably null
R7062:Fat1 UTSW 8 44950216 start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45040775 missense probably benign 0.09
R7071:Fat1 UTSW 8 44989108 missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45031468 missense probably damaging 0.98
R7146:Fat1 UTSW 8 44950925 missense probably benign
R7210:Fat1 UTSW 8 45023503 missense probably damaging 1.00
R7227:Fat1 UTSW 8 45010609 missense probably benign 0.08
R7270:Fat1 UTSW 8 45037438 missense probably damaging 1.00
R7373:Fat1 UTSW 8 45026665 missense probably damaging 1.00
R7390:Fat1 UTSW 8 44952474 missense possibly damaging 0.81
X0064:Fat1 UTSW 8 45025734 missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45023807 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTATTACAGGTGGCCAGGAG -3'
(R):5'- TCCACTGCCTTGACGATCAG -3'

Sequencing Primer
(F):5'- ATGGCAGCCAAAGACTTG -3'
(R):5'- GATCAGCGTGTAATGGTCTCTCAC -3'
Posted On2014-10-16