Incidental Mutation 'R2257:Nom1'
ID243436
Institutional Source Beutler Lab
Gene Symbol Nom1
Ensembl Gene ENSMUSG00000001569
Gene Namenucleolar protein with MIF4G domain 1
SynonymsGm1040, LOC381627, D5Kng1
MMRRC Submission 040257-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2257 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location29434664-29457843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29437752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 417 (V417D)
Ref Sequence ENSEMBL: ENSMUSP00000001611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001611]
Predicted Effect probably damaging
Transcript: ENSMUST00000001611
AA Change: V417D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001611
Gene: ENSMUSG00000001569
AA Change: V417D

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 102 114 N/A INTRINSIC
low complexity region 119 147 N/A INTRINSIC
coiled coil region 170 197 N/A INTRINSIC
low complexity region 227 250 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
MIF4G 356 553 1.1e-21 SMART
MA3 649 755 1.59e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146347
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that contain MIF4G (middle of eIF4G (MIM 600495)) and/or MA3 domains, such as NOM1, function in protein translation. These domains include binding sites for members of the EIF4A family of ATP-dependent DEAD box RNA helicases (see EIF4A1; MIM 602641) (Simmons et al., 2005 [PubMed 15715967]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4930567H17Rik A T X: 70,394,406 W94R probably damaging Het
4931409K22Rik C T 5: 24,552,040 probably benign Het
Abcc3 C T 11: 94,363,594 V693M probably damaging Het
Acp7 A C 7: 28,614,413 W399G probably damaging Het
Ap1s1 T C 5: 137,041,779 Y94C possibly damaging Het
Arhgap32 T C 9: 32,247,497 I186T probably damaging Het
Atg4a A G X: 140,990,235 I91V probably benign Het
Atp7b T G 8: 21,998,266 T1102P probably damaging Het
Cabs1 T C 5: 87,980,215 S242P probably damaging Het
Cass4 T C 2: 172,427,470 F493L probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cdk14 T A 5: 4,888,924 M433L probably benign Het
Cep162 C A 9: 87,206,914 D972Y probably damaging Het
Cfap100 C G 6: 90,413,820 R184P possibly damaging Het
Clasrp A G 7: 19,586,585 probably benign Het
Copb1 T A 7: 114,253,875 D29V possibly damaging Het
Cyp2b9 G A 7: 26,173,605 probably null Het
Dhx36 C T 3: 62,477,643 G683S probably damaging Het
Dnah10 T A 5: 124,761,237 I1110N probably damaging Het
Dnajc3 C G 14: 118,972,702 P322A probably benign Het
Eml4 A G 17: 83,477,760 T785A probably damaging Het
Fam228a T C 12: 4,737,775 probably benign Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fam90a1a T A 8: 21,963,517 L296Q possibly damaging Het
Fat1 A G 8: 44,950,371 Y53C probably damaging Het
Fcrls T C 3: 87,259,621 I22V probably damaging Het
Fryl T A 5: 73,072,844 N1657Y possibly damaging Het
Greb1l A G 18: 10,503,307 M453V possibly damaging Het
Grm8 A T 6: 27,760,225 C369S probably damaging Het
Hdc G A 2: 126,616,080 probably null Het
Hsf3 A T X: 96,320,322 L191* probably null Het
Kif4 A T X: 100,726,131 N1126Y probably benign Het
Lat2 T C 5: 134,602,627 D191G probably damaging Het
Lipt2 C T 7: 100,159,394 T38I probably benign Het
Lmo7 T C 14: 101,900,130 L634P probably damaging Het
Lrrc6 T A 15: 66,437,587 probably benign Het
Magea2 A T X: 155,027,859 L243Q probably damaging Het
Mctp2 A G 7: 72,185,820 L543P probably damaging Het
Mgat4a T C 1: 37,490,313 N24D probably benign Het
Mical3 A T 6: 121,033,735 S429T possibly damaging Het
Mrps35 A G 6: 147,070,627 E256G possibly damaging Het
Mybbp1a T A 11: 72,446,195 S586T probably benign Het
Myo1e G A 9: 70,378,373 probably null Het
Nob1 A G 8: 107,417,097 probably benign Het
Nphs1 A T 7: 30,467,992 I782F possibly damaging Het
Numa1 A G 7: 102,000,791 E1243G probably damaging Het
Olfr676 A G 7: 105,035,819 Y207C probably benign Het
Olfr845 A G 9: 19,338,493 E11G probably benign Het
Padi4 G A 4: 140,759,940 T217I possibly damaging Het
Pias3 C T 3: 96,699,646 T75I probably benign Het
Ppp1r37 G T 7: 19,562,018 probably benign Het
Prrc2a G A 17: 35,161,068 P185L unknown Het
Prss57 C T 10: 79,787,370 C81Y probably damaging Het
Psen1 C T 12: 83,714,820 S132L probably damaging Het
Ranbp6 A G 19: 29,811,549 S468P possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc2a9 T C 5: 38,453,199 T86A probably damaging Het
Slco1a6 A T 6: 142,091,016 M555K probably benign Het
Thoc1 C A 18: 9,993,466 D608E possibly damaging Het
Tmem121b A G 6: 120,492,071 Y562H probably damaging Het
Tmem121b A T 6: 120,492,069 Y562* probably null Het
Tmprss7 A T 16: 45,686,333 M122K possibly damaging Het
Tmub1 C A 5: 24,446,924 G14V possibly damaging Het
Uap1 A T 1: 170,158,743 probably benign Het
Ugdh A T 5: 65,417,115 probably benign Het
Vmn2r59 A T 7: 42,012,245 C715* probably null Het
Vps13a G A 19: 16,682,174 T1663I possibly damaging Het
Vps13c A C 9: 67,952,946 I2815L possibly damaging Het
Zc3h3 G T 15: 75,839,566 Q349K possibly damaging Het
Other mutations in Nom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Nom1 APN 5 29446274 missense possibly damaging 0.74
IGL01795:Nom1 APN 5 29446871 missense probably benign 0.06
IGL02308:Nom1 APN 5 29437710 missense probably damaging 1.00
IGL02378:Nom1 APN 5 29451126 nonsense probably null
IGL02506:Nom1 APN 5 29439816 splice site probably benign
R0633:Nom1 UTSW 5 29451100 missense probably damaging 1.00
R0652:Nom1 UTSW 5 29435311 missense probably damaging 1.00
R1571:Nom1 UTSW 5 29442635 nonsense probably null
R1707:Nom1 UTSW 5 29435318 missense probably damaging 0.99
R1852:Nom1 UTSW 5 29446878 missense possibly damaging 0.46
R2025:Nom1 UTSW 5 29446851 missense probably damaging 1.00
R2196:Nom1 UTSW 5 29436021 missense probably benign 0.00
R2207:Nom1 UTSW 5 29439974 missense probably damaging 1.00
R2256:Nom1 UTSW 5 29437752 missense probably damaging 1.00
R2680:Nom1 UTSW 5 29443417 missense probably damaging 1.00
R3439:Nom1 UTSW 5 29435617 missense probably benign 0.01
R4291:Nom1 UTSW 5 29446372 critical splice donor site probably null
R4587:Nom1 UTSW 5 29451165 missense possibly damaging 0.91
R5374:Nom1 UTSW 5 29441379 missense probably damaging 1.00
R5761:Nom1 UTSW 5 29437641 missense probably damaging 1.00
R5772:Nom1 UTSW 5 29446875 missense possibly damaging 0.81
R5828:Nom1 UTSW 5 29435126 missense possibly damaging 0.53
R5963:Nom1 UTSW 5 29437770 missense probably damaging 1.00
R6208:Nom1 UTSW 5 29449619 missense possibly damaging 0.83
R7234:Nom1 UTSW 5 29435453 missense probably benign 0.01
R7476:Nom1 UTSW 5 29442536 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATTCCACTGCAGGTTGAGTG -3'
(R):5'- CCCTTGGTGGAGAGATGATCATAG -3'

Sequencing Primer
(F):5'- CTGCAGGTTGAGTGAGCCAAAC -3'
(R):5'- CAATTCCTAAGGTAGCCAGGGTAGTC -3'
Posted On2014-10-16