Incidental Mutation 'R2258:Gsn'
ID243507
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Namegelsolin
Synonyms
MMRRC Submission 040258-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R2258 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35256380-35307892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35290337 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 130 (G130E)
Ref Sequence ENSEMBL: ENSMUSP00000144296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000139867] [ENSMUST00000142324] [ENSMUST00000201185] [ENSMUST00000202899] [ENSMUST00000202990]
Predicted Effect probably damaging
Transcript: ENSMUST00000028239
AA Change: G168E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879
AA Change: G168E

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139867
AA Change: G130E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144217
Gene: ENSMUSG00000026879
AA Change: G130E

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142324
AA Change: G119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118120
Gene: ENSMUSG00000026879
AA Change: G119E

DomainStartEndE-ValueType
GEL 15 113 7.31e-30 SMART
GEL 134 226 1.53e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201185
AA Change: G119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879
AA Change: G119E

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202899
AA Change: G119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144470
Gene: ENSMUSG00000026879
AA Change: G119E

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202990
AA Change: G130E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: G130E

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,618 N308S possibly damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Ang4 A G 14: 51,764,498 probably benign Het
Ap3d1 A G 10: 80,721,132 S315P probably benign Het
Arhgap15 G A 2: 44,386,347 G437R probably damaging Het
Cacna2d1 T C 5: 16,357,289 C810R probably damaging Het
Capn5 A G 7: 98,135,875 W131R probably damaging Het
Ccnj A G 19: 40,845,833 Q292R probably benign Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdk5r2 T C 1: 74,855,900 L268P probably damaging Het
Clrn2 A G 5: 45,453,962 D51G probably benign Het
Cntd1 T C 11: 101,284,856 S174P probably damaging Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Col17a1 C T 19: 47,681,377 probably null Het
Cyp2a5 A G 7: 26,837,103 D169G possibly damaging Het
Cyp2c37 A G 19: 39,995,859 I264V possibly damaging Het
Cyp2j12 A G 4: 96,133,078 I97T probably damaging Het
Eif3b T C 5: 140,427,503 F354L possibly damaging Het
Entpd2 C T 2: 25,398,087 P108S probably damaging Het
F5 T A 1: 164,192,181 S742T probably damaging Het
Fam187a A G 11: 102,885,298 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fam69b T C 2: 26,635,150 L157P probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Fndc3b G T 3: 27,440,160 Q939K possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gm11565 T G 11: 99,915,018 C79G possibly damaging Het
Gm17689 C A 9: 36,581,865 V54L probably benign Het
Gm5065 A G 7: 5,359,402 M11V probably benign Het
Gm8994 A T 6: 136,328,561 M7L probably benign Het
Gpbar1 T C 1: 74,279,005 F136L probably benign Het
Hecw1 A T 13: 14,316,138 D756E probably benign Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Inpp4a T A 1: 37,377,696 S433T probably damaging Het
Ism2 C A 12: 87,280,074 V320L possibly damaging Het
Krt8 G T 15: 101,998,822 D275E probably benign Het
Lyg2 A C 1: 37,908,996 N132K probably benign Het
Lyst G A 13: 13,637,658 R885Q probably benign Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mcc C A 18: 44,475,136 G355W probably damaging Het
Mettl7a1 A T 15: 100,313,168 I174F probably benign Het
Mllt6 T C 11: 97,664,976 V44A probably damaging Het
Mrgpra3 A T 7: 47,590,094 M28K probably benign Het
Ms4a15 A G 19: 10,984,795 C47R probably benign Het
Muc5ac A G 7: 141,791,008 N72S probably benign Het
Myo18b C T 5: 112,874,663 probably benign Het
Nat8f4 A T 6: 85,901,225 H105Q possibly damaging Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nptx1 T G 11: 119,543,316 I315L probably benign Het
Nrap T C 19: 56,321,962 R1534G possibly damaging Het
Nwd2 C A 5: 63,805,156 N694K probably benign Het
Oas1c G A 5: 120,803,017 A35V probably null Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr1532-ps1 A G 7: 106,914,906 K236R probably damaging Het
Olfr482 C T 7: 108,095,195 R125H possibly damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Prex1 C T 2: 166,587,157 V839I probably benign Het
Psmd3 T A 11: 98,690,964 M305K probably benign Het
Rbm20 T C 19: 53,851,741 S1054P probably benign Het
Rhox13 G C X: 38,121,344 E19Q unknown Het
Ryr2 A G 13: 11,738,216 F1740L possibly damaging Het
Sox1 C A 8: 12,396,927 N189K possibly damaging Het
Spta1 C A 1: 174,174,341 S12R possibly damaging Het
Stard13 A G 5: 151,039,731 L971P probably damaging Het
Tigd4 T A 3: 84,594,293 N172K probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Twistnb A G 12: 33,433,588 H113R probably damaging Het
Unc45b T A 11: 82,917,799 M237K probably benign Het
Vldlr A G 19: 27,238,386 D220G probably damaging Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Wdr25 T A 12: 108,898,174 S82T possibly damaging Het
Wdr66 C G 5: 123,283,348 probably null Het
Wnk4 C A 11: 101,275,035 P796Q probably damaging Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Zc3h15 G A 2: 83,657,016 V60I probably benign Het
Zfp629 G A 7: 127,611,791 T282M probably damaging Het
Zscan22 T G 7: 12,903,960 V93G probably damaging Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35284037 missense probably damaging 1.00
IGL02119:Gsn APN 2 35302495 missense probably damaging 1.00
IGL02512:Gsn APN 2 35283950 nonsense probably null
IGL02550:Gsn APN 2 35282607 intron probably benign
IGL02975:Gsn APN 2 35304654 missense probably benign 0.25
IGL03061:Gsn APN 2 35282459 intron probably benign
R0321:Gsn UTSW 2 35290396 missense probably benign 0.03
R0454:Gsn UTSW 2 35304639 missense probably damaging 1.00
R1446:Gsn UTSW 2 35306586 missense probably benign 0.04
R1760:Gsn UTSW 2 35284823 missense probably damaging 1.00
R1974:Gsn UTSW 2 35301471 missense probably damaging 1.00
R2260:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2281:Gsn UTSW 2 35283918 missense probably benign 0.01
R2495:Gsn UTSW 2 35303193 missense probably damaging 1.00
R2516:Gsn UTSW 2 35283953 missense probably benign
R3896:Gsn UTSW 2 35302638 missense possibly damaging 0.92
R4003:Gsn UTSW 2 35283983 missense probably benign 0.38
R4006:Gsn UTSW 2 35307621 nonsense probably null
R4281:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4291:Gsn UTSW 2 35290420 missense probably benign 0.14
R4692:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4850:Gsn UTSW 2 35283900 splice site probably null
R4895:Gsn UTSW 2 35302578 missense probably damaging 1.00
R5011:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5013:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5290:Gsn UTSW 2 35296472 missense probably benign 0.01
R6472:Gsn UTSW 2 35290451 unclassified probably null
R6764:Gsn UTSW 2 35284044 missense probably damaging 1.00
R7018:Gsn UTSW 2 35293506 missense probably benign 0.03
R7036:Gsn UTSW 2 35292599 missense probably damaging 1.00
R7097:Gsn UTSW 2 35295049 nonsense probably null
R7122:Gsn UTSW 2 35295049 nonsense probably null
R7183:Gsn UTSW 2 35294948 missense probably benign 0.00
R7203:Gsn UTSW 2 35298795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGTGGAGGGAATCTTAGCC -3'
(R):5'- GCAGGCAAGACTCACGTTTC -3'

Sequencing Primer
(F):5'- GAGGGAATCTTAGCCATGTGG -3'
(R):5'- CGTTTCCCAGGTCCAGAATGAAG -3'
Posted On2014-10-16