Incidental Mutation 'R2260:Entpd2'
ID243700
Institutional Source Beutler Lab
Gene Symbol Entpd2
Ensembl Gene ENSMUSG00000015085
Gene Nameectonucleoside triphosphate diphosphohydrolase 2
SynonymsCd39l1, NTPDase2
MMRRC Submission 040260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2260 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25395874-25401321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25398087 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 108 (P108S)
Ref Sequence ENSEMBL: ENSMUSP00000028328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028328] [ENSMUST00000071442]
Predicted Effect probably damaging
Transcript: ENSMUST00000028328
AA Change: P108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028328
Gene: ENSMUSG00000015085
AA Change: P108S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:GDA1_CD39 32 459 9.7e-104 PFAM
low complexity region 465 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071442
SMART Domains Protein: ENSMUSP00000071387
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 332 7.2e-217 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148859
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the type 2 enzyme of the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). E-NTPDases are a family of ecto-nucleosidases that hydrolyze 5'-triphosphates. This ecto-ATPase is an integral membrane protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display smaller circumvallate papilla size and reduced neural responses to taste stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,216,917 N1252I probably damaging Het
Acot5 A T 12: 84,075,869 H409L possibly damaging Het
Adgrv1 A T 13: 81,568,374 V840E probably damaging Het
Adnp2 A T 18: 80,128,449 M915K probably benign Het
Cd101 G C 3: 101,016,945 L393V possibly damaging Het
Cd177 A G 7: 24,756,236 V287A possibly damaging Het
Cdc37l1 A T 19: 29,007,048 K194N probably benign Het
Cep126 T C 9: 8,101,748 T262A possibly damaging Het
Chit1 A G 1: 134,151,127 S392G probably benign Het
Col11a2 A G 17: 34,039,677 H8R probably benign Het
Dusp12 C T 1: 170,881,011 R120H probably damaging Het
Eln C A 5: 134,729,654 A126S unknown Het
Fkbp6 C T 5: 135,337,614 probably null Het
Ftcd T A 10: 76,588,059 probably null Het
Gdf10 T C 14: 33,932,277 L247P probably damaging Het
Gigyf1 C A 5: 137,520,332 A215E possibly damaging Het
Gja4 C A 4: 127,312,830 D47Y probably damaging Het
Gsn G A 2: 35,290,337 G130E probably damaging Het
Hrasls5 C T 19: 7,612,746 R46C probably damaging Het
Hrc C A 7: 45,336,681 R419S possibly damaging Het
Itfg1 C T 8: 85,722,677 C576Y probably damaging Het
Lama1 G T 17: 67,737,507 A134S probably damaging Het
Larp4 T G 15: 99,997,396 F283L possibly damaging Het
Marveld2 A G 13: 100,612,470 S34P probably benign Het
Mettl18 T A 1: 163,996,825 D238E probably benign Het
Mfn1 G T 3: 32,563,426 E74* probably null Het
Mfn2 C A 4: 147,894,606 E90* probably null Het
Mill2 T A 7: 18,856,488 D164E probably benign Het
Ncapd3 A G 9: 27,056,072 D568G probably benign Het
Nt5c1b A T 12: 10,374,965 R170S probably damaging Het
Olfr1186 G A 2: 88,526,386 V268I possibly damaging Het
Olfr1333 T C 4: 118,830,162 I93V probably damaging Het
Olfr1350 A T 7: 6,570,023 I11F probably damaging Het
Olfr933 T C 9: 38,976,000 V108A probably benign Het
Pald1 G A 10: 61,352,971 R87W probably damaging Het
Paox T A 7: 140,134,054 Y242* probably null Het
Pde2a A T 7: 101,484,567 D85V probably damaging Het
Pitrm1 C T 13: 6,560,125 T411I probably damaging Het
Pkd1l3 A G 8: 109,623,636 Q371R probably benign Het
Ptprk A G 10: 28,206,149 D38G possibly damaging Het
Rag2 G A 2: 101,630,238 E298K probably benign Het
Rbm12b2 G A 4: 12,095,061 R640H probably benign Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rims2 G T 15: 39,478,566 E604* probably null Het
Rin2 A G 2: 145,878,904 D719G probably damaging Het
Sash1 G A 10: 8,786,378 Q155* probably null Het
Tacr1 A T 6: 82,403,775 I56F probably damaging Het
Tbc1d4 G A 14: 101,494,411 T455M probably damaging Het
Tex24 C T 8: 27,344,855 T137I probably damaging Het
Tmem200a A C 10: 25,993,415 S319A probably benign Het
Tmem242 G T 17: 5,433,470 A99E probably damaging Het
Tmem30a C T 9: 79,774,164 R277H probably benign Het
Tmprss11f G A 5: 86,591,410 A4V probably benign Het
Triobp T G 15: 78,991,440 probably null Het
Tshz2 A T 2: 169,886,406 Q505L probably benign Het
Ttyh1 T C 7: 4,128,184 V218A probably damaging Het
Vmn2r11 A T 5: 109,053,791 Y282* probably null Het
Vps13c A G 9: 67,953,860 N2891S probably benign Het
Xpo5 C T 17: 46,240,896 Q1050* probably null Het
Other mutations in Entpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Entpd2 APN 2 25398734 missense probably benign
IGL02869:Entpd2 APN 2 25398108 missense probably damaging 1.00
IGL03170:Entpd2 APN 2 25399481 missense probably damaging 1.00
R1280:Entpd2 UTSW 2 25399484 missense probably damaging 1.00
R2258:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2420:Entpd2 UTSW 2 25399283 missense probably benign
R2566:Entpd2 UTSW 2 25399283 missense probably benign 0.16
R4802:Entpd2 UTSW 2 25399764 unclassified probably null
R4938:Entpd2 UTSW 2 25399417 missense probably benign 0.25
R5239:Entpd2 UTSW 2 25400818 missense probably damaging 0.96
R5374:Entpd2 UTSW 2 25399726 missense probably damaging 1.00
R5739:Entpd2 UTSW 2 25399492 missense possibly damaging 0.90
R5752:Entpd2 UTSW 2 25399769 unclassified probably benign
R5881:Entpd2 UTSW 2 25400812 missense probably damaging 1.00
R6016:Entpd2 UTSW 2 25398556 missense probably damaging 0.99
R6120:Entpd2 UTSW 2 25399466 missense probably benign 0.03
R6370:Entpd2 UTSW 2 25397417 missense probably damaging 1.00
R7301:Entpd2 UTSW 2 25400909 missense possibly damaging 0.88
X0009:Entpd2 UTSW 2 25398679 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTTGTCTCCAATTTGGGAAG -3'
(R):5'- AGCAGGTAGTTGGCAGTCAC -3'

Sequencing Primer
(F):5'- AATTTGGGAAGGTGTGTCTAAATAGC -3'
(R):5'- TAGTTGGCAGTCACCCAGC -3'
Posted On2014-10-16