Incidental Mutation 'R2261:Slc20a1'
ID243774
Institutional Source Beutler Lab
Gene Symbol Slc20a1
Ensembl Gene ENSMUSG00000027397
Gene Namesolute carrier family 20, member 1
SynonymsPiT-1, Glvr1, Glvr-1
MMRRC Submission 040261-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2261 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129198764-129211616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129206474 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 260 (R260G)
Ref Sequence ENSEMBL: ENSMUSP00000105944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028880] [ENSMUST00000110315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028880
AA Change: R260G

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028880
Gene: ENSMUSG00000027397
AA Change: R260G

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.8e-162 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110315
AA Change: R260G

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105944
Gene: ENSMUSG00000027397
AA Change: R260G

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.3e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144025
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-phosphate symporter that absorbs phosphate from interstitial fluid for use in cellular functions such as metabolism, signal transduction, and nucleic acid and lipid synthesis. The encoded protein is also a retroviral receptor, causing human cells to be susceptible to infection by gibbon ape leukemia virus, simian sarcoma-associated virus, feline leukemia virus subgroup B, and 10A1 murine leukemia virus.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit mid-gestation lethality associated with abnormal vitelline vasculature, growth retardation, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,288 M1384L probably benign Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Arhgap31 T A 16: 38,609,277 Q412L probably damaging Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Cacna1g T A 11: 94,457,135 H709L probably benign Het
Cacna1h T C 17: 25,433,165 T2A possibly damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap69 C A 5: 5,596,018 V561F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fam184a A G 10: 53,647,570 probably null Het
Fanca A G 8: 123,289,359 probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Gbp2b G A 3: 142,606,735 S293N probably benign Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Gm12874 G A 4: 122,593,740 noncoding transcript Het
Golgb1 T A 16: 36,893,360 F234L probably damaging Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Grip1 G A 10: 119,985,584 V385M probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mast4 A G 13: 102,798,207 probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Morc3 T A 16: 93,853,221 probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Npy2r A G 3: 82,541,039 V30A possibly damaging Het
Nsd2 A T 5: 33,885,527 Q1045L probably damaging Het
Olfr1168 T A 2: 88,185,621 I248N probably damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Otub1 T A 19: 7,199,496 probably null Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhm2 C T 4: 141,642,732 E29K probably damaging Het
Ralgapa2 T C 2: 146,342,683 N1468S probably damaging Het
Rnf111 T C 9: 70,476,391 S87G probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Slk T C 19: 47,637,352 I1090T probably damaging Het
Spr-ps1 G T 6: 85,155,963 noncoding transcript Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
St18 T A 1: 6,845,572 C814S probably damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Taar3 A G 10: 23,950,155 I200V probably benign Het
Tmem184c A G 8: 77,597,043 Y397H probably damaging Het
Tmem184c T C 8: 77,597,175 T353A probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Ubr4 T C 4: 139,413,462 S1231P probably damaging Het
Ubr5 A T 15: 37,988,284 D2143E probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Zmym2 G A 14: 56,928,262 E681K probably damaging Het
Other mutations in Slc20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Slc20a1 APN 2 129209226 splice site probably benign
IGL02563:Slc20a1 APN 2 129207684 missense probably benign
R0037:Slc20a1 UTSW 2 129210772 missense probably damaging 1.00
R0514:Slc20a1 UTSW 2 129199891 missense probably damaging 1.00
R1221:Slc20a1 UTSW 2 129208404 missense probably benign 0.44
R2099:Slc20a1 UTSW 2 129207838 missense probably benign 0.00
R2122:Slc20a1 UTSW 2 129199819 missense possibly damaging 0.86
R2426:Slc20a1 UTSW 2 129208230 missense probably benign 0.13
R3428:Slc20a1 UTSW 2 129200282 missense probably benign
R4712:Slc20a1 UTSW 2 129199691 splice site probably benign
R4981:Slc20a1 UTSW 2 129199999 missense probably damaging 1.00
R5213:Slc20a1 UTSW 2 129200509 missense probably damaging 1.00
R5395:Slc20a1 UTSW 2 129208337 missense probably damaging 1.00
R5506:Slc20a1 UTSW 2 129210819 missense probably benign 0.00
R6255:Slc20a1 UTSW 2 129208004 missense probably damaging 0.99
R6266:Slc20a1 UTSW 2 129209894 missense possibly damaging 0.78
R7022:Slc20a1 UTSW 2 129200059 missense probably damaging 0.99
R7091:Slc20a1 UTSW 2 129208272 missense possibly damaging 0.85
R7175:Slc20a1 UTSW 2 129210742 missense probably damaging 1.00
R7250:Slc20a1 UTSW 2 129209924 missense possibly damaging 0.78
X0067:Slc20a1 UTSW 2 129199888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTTACACATTGTTGCAGG -3'
(R):5'- TTACAGCTCTAGCACAAGGATAG -3'

Sequencing Primer
(F):5'- CACATTGTTGCAGGGGGCTG -3'
(R):5'- GTGCAAAAGTGTGTCTGCATTACAC -3'
Posted On2014-10-16