Incidental Mutation 'R2262:Casz1'
ID243851
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 040262-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2262 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 148929099 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 40 (R40L)
Ref Sequence ENSEMBL: ENSMUSP00000116095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000139806] [ENSMUST00000147270]
Predicted Effect probably damaging
Transcript: ENSMUST00000094464
AA Change: R40L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977
AA Change: R40L

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122222
AA Change: R40L

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: R40L

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139806
SMART Domains Protein: ENSMUSP00000120307
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 117 134 N/A INTRINSIC
ZnF_C2H2 203 228 5.34e0 SMART
ZnF_C2H2 264 288 8.09e-1 SMART
ZnF_C2H2 323 347 9.3e-1 SMART
low complexity region 357 372 N/A INTRINSIC
ZnF_C2H2 381 405 1.1e-2 SMART
low complexity region 412 425 N/A INTRINSIC
low complexity region 442 480 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 524 548 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147270
AA Change: R40L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Cass4 T C 2: 172,427,254 S421P probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Trpc1 T A 9: 95,706,933 N746I probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAACTGTGTCGATCAAGGG -3'
(R):5'- CTCCTGATCACGGGCAATAC -3'

Sequencing Primer
(F):5'- GTCGATCAAGGGGGTGC -3'
(R):5'- TGCGGGATCCTCACAGTACTC -3'
Posted On2014-10-16