Incidental Mutation 'R2262:4932431P20Rik'
ID243868
Institutional Source Beutler Lab
Gene Symbol 4932431P20Rik
Ensembl Gene ENSMUSG00000074224
Gene NameRIKEN cDNA 4932431P20 gene
Synonyms
MMRRC Submission 040262-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2262 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29519205-29538057 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 29532562 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098602
SMART Domains Protein: ENSMUSP00000096202
Gene: ENSMUSG00000074224

DomainStartEndE-ValueType
low complexity region 233 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141713
SMART Domains Protein: ENSMUSP00000120285
Gene: ENSMUSG00000074224

DomainStartEndE-ValueType
Blast:WD40 94 134 1e-9 BLAST
WD40 139 176 1.59e1 SMART
WD40 228 269 9.51e1 SMART
WD40 272 311 3.33e-1 SMART
Blast:WD40 354 393 4e-15 BLAST
Blast:WD40 445 490 2e-22 BLAST
Blast:WD40 493 538 8e-15 BLAST
WD40 595 634 1.68e-6 SMART
low complexity region 701 710 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
coiled coil region 1135 1168 N/A INTRINSIC
low complexity region 1211 1230 N/A INTRINSIC
low complexity region 1239 1273 N/A INTRINSIC
coiled coil region 1347 1375 N/A INTRINSIC
coiled coil region 1399 1433 N/A INTRINSIC
low complexity region 1435 1453 N/A INTRINSIC
low complexity region 1497 1519 N/A INTRINSIC
coiled coil region 1612 1707 N/A INTRINSIC
coiled coil region 1731 1989 N/A INTRINSIC
coiled coil region 2034 2072 N/A INTRINSIC
coiled coil region 2127 2154 N/A INTRINSIC
coiled coil region 2220 2302 N/A INTRINSIC
coiled coil region 2357 2561 N/A INTRINSIC
low complexity region 2993 2999 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 A G 4: 133,063,163 T572A unknown Het
Bco1 T C 8: 117,133,025 L489S probably damaging Het
Brinp1 A G 4: 68,829,354 Y171H probably damaging Het
C1rl A T 6: 124,506,948 I186F probably damaging Het
Cacna1d A G 14: 30,491,016 V29A possibly damaging Het
Calcrl T C 2: 84,345,173 D279G probably damaging Het
Cass4 T C 2: 172,427,254 S421P probably damaging Het
Casz1 G T 4: 148,929,099 R40L probably damaging Het
Cdh23 A G 10: 60,317,128 V2372A probably damaging Het
Cdk17 T A 10: 93,211,958 S56T possibly damaging Het
Ces2h T A 8: 105,016,559 M142K probably damaging Het
Cfap161 C T 7: 83,793,372 V78I probably benign Het
Chst8 T A 7: 34,676,010 M135L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dcc C T 18: 71,374,551 E917K probably damaging Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dnajc3 A G 14: 118,960,820 Q118R probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Fnbp4 G T 2: 90,757,404 L375F probably damaging Het
Gbp8 T C 5: 105,016,133 Q433R possibly damaging Het
Glt1d1 A G 5: 127,657,112 M117V probably benign Het
Hcar1 A C 5: 123,878,586 D347E probably benign Het
Kif16b T C 2: 142,740,917 K563E probably damaging Het
Klra17 A G 6: 129,874,794 probably null Het
Krt35 C T 11: 100,095,767 M140I probably benign Het
Lamb2 A T 9: 108,480,610 I111F probably damaging Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Noa1 G A 5: 77,309,804 Q85* probably null Het
Nsun4 A T 4: 116,052,950 S138T probably benign Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Pde1a T A 2: 80,128,931 probably benign Het
Pdgfra T C 5: 75,185,523 V778A probably benign Het
Plekhj1 A T 10: 80,796,472 N55K probably benign Het
Ptpn20 A G 14: 33,612,311 M49V probably benign Het
Rbm6 A G 9: 107,791,090 L547P probably damaging Het
Rexo1 C T 10: 80,549,569 E552K probably benign Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Saxo1 C T 4: 86,478,975 D109N probably damaging Het
Setd2 A G 9: 110,561,243 probably benign Het
Slc22a28 T C 19: 8,071,208 Y358C probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Ssh1 T C 5: 113,942,703 S867G possibly damaging Het
Stmn2 T C 3: 8,541,895 F25S probably damaging Het
Tcirg1 C T 19: 3,903,591 R112H possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Trpc1 T A 9: 95,706,933 N746I probably damaging Het
Tuba1c A G 15: 99,037,876 H406R probably damaging Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Vcp T C 4: 42,980,828 T761A probably benign Het
Vmn1r68 T C 7: 10,527,445 E242G probably damaging Het
Vmn2r29 T A 7: 7,240,086 H22L possibly damaging Het
Vmn2r32 T A 7: 7,474,619 I258L probably benign Het
Vmn2r37 T A 7: 9,217,944 T307S probably damaging Het
Vmn2r6 T C 3: 64,556,669 N248S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vmn2r67 T C 7: 85,136,974 T608A probably damaging Het
Xpo1 T A 11: 23,284,634 probably null Het
Zfp180 T G 7: 24,104,624 V156G probably benign Het
Zfp37 A T 4: 62,191,636 L397Q probably damaging Het
Other mutations in 4932431P20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:4932431P20Rik APN 7 29537622 exon noncoding transcript
IGL00505:4932431P20Rik APN 7 29534183 exon noncoding transcript
IGL00557:4932431P20Rik APN 7 29535802 exon noncoding transcript
IGL00569:4932431P20Rik APN 7 29534140 exon noncoding transcript
IGL00966:4932431P20Rik APN 7 29537463 exon noncoding transcript
IGL01668:4932431P20Rik APN 7 29537430 exon noncoding transcript
K7371:4932431P20Rik UTSW 7 29530992 exon noncoding transcript
P0037:4932431P20Rik UTSW 7 29533614 exon noncoding transcript
R0179:4932431P20Rik UTSW 7 29535940 exon noncoding transcript
R0357:4932431P20Rik UTSW 7 29535582 exon noncoding transcript
R0358:4932431P20Rik UTSW 7 29532211 exon noncoding transcript
R0412:4932431P20Rik UTSW 7 29530570 exon noncoding transcript
R0530:4932431P20Rik UTSW 7 29530120 exon noncoding transcript
R0600:4932431P20Rik UTSW 7 29533265 exon noncoding transcript
R0675:4932431P20Rik UTSW 7 29532517 exon noncoding transcript
R1118:4932431P20Rik UTSW 7 29534244 exon noncoding transcript
R1395:4932431P20Rik UTSW 7 29531387 exon noncoding transcript
R1444:4932431P20Rik UTSW 7 29529955 exon noncoding transcript
R1476:4932431P20Rik UTSW 7 29534890 exon noncoding transcript
R1534:4932431P20Rik UTSW 7 29530429 exon noncoding transcript
R1535:4932431P20Rik UTSW 7 29529579 exon noncoding transcript
R2023:4932431P20Rik UTSW 7 29531534 exon noncoding transcript
R2127:4932431P20Rik UTSW 7 29537140 exon noncoding transcript
R2141:4932431P20Rik UTSW 7 29531510 exon noncoding transcript
R2198:4932431P20Rik UTSW 7 29527272 exon noncoding transcript
R2201:4932431P20Rik UTSW 7 29536525 exon noncoding transcript
R2263:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R4874:4932431P20Rik UTSW 7 29536183 exon noncoding transcript
R5064:4932431P20Rik UTSW 7 29535655 exon noncoding transcript
R5130:4932431P20Rik UTSW 7 29529274 exon noncoding transcript
R5366:4932431P20Rik UTSW 7 29533539 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCACTACCACTACTGAGGAGGA -3'
(R):5'- GGCATCTCTTCCTGACCTGTGA -3'

Sequencing Primer
(F):5'- GAGAACTCACAGAATGTCTTCTCGG -3'
(R):5'- GACCTGTGACTTCCTCTCTAGTTG -3'
Posted On2014-10-16