Incidental Mutation 'R2263:Slx4ip'
ID243910
Institutional Source Beutler Lab
Gene Symbol Slx4ip
Ensembl Gene ENSMUSG00000027281
Gene NameSLX4 interacting protein
Synonyms
MMRRC Submission 040263-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location136891218-137071950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137044015 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 85 (I85T)
Ref Sequence ENSEMBL: ENSMUSP00000136131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028737] [ENSMUST00000099311] [ENSMUST00000180277]
Predicted Effect probably benign
Transcript: ENSMUST00000028737
AA Change: S45P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028737
Gene: ENSMUSG00000027281
AA Change: S45P

DomainStartEndE-ValueType
low complexity region 271 292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099311
AA Change: I85T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096914
Gene: ENSMUSG00000027281
AA Change: I85T

DomainStartEndE-ValueType
Pfam:UPF0492 10 365 6.4e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135260
Predicted Effect probably damaging
Transcript: ENSMUST00000180277
AA Change: I85T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136131
Gene: ENSMUSG00000027281
AA Change: I85T

DomainStartEndE-ValueType
low complexity region 341 362 N/A INTRINSIC
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nell1 C T 7: 50,560,821 T494I possibly damaging Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Slx4ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Slx4ip APN 2 137044055 nonsense probably null
IGL01546:Slx4ip APN 2 137066199 missense probably benign
IGL02114:Slx4ip APN 2 137000200 missense probably damaging 1.00
IGL02142:Slx4ip APN 2 137068022 missense possibly damaging 0.87
IGL02253:Slx4ip APN 2 137000275 critical splice donor site probably null
IGL02826:Slx4ip APN 2 137004973 missense probably damaging 1.00
IGL03035:Slx4ip APN 2 137067703 missense possibly damaging 0.50
IGL03261:Slx4ip APN 2 137046739 missense probably benign 0.01
R0561:Slx4ip UTSW 2 137066170 missense probably null 0.27
R1750:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R1774:Slx4ip UTSW 2 137067723 missense probably damaging 0.99
R1812:Slx4ip UTSW 2 137068195 missense probably benign 0.13
R1894:Slx4ip UTSW 2 137068118 missense probably benign 0.02
R1961:Slx4ip UTSW 2 137067681 missense probably benign 0.02
R2051:Slx4ip UTSW 2 137066205 missense possibly damaging 0.90
R2914:Slx4ip UTSW 2 137067591 critical splice acceptor site probably null
R3798:Slx4ip UTSW 2 137067623 missense probably benign 0.19
R4061:Slx4ip UTSW 2 137005017 missense probably benign 0.08
R4934:Slx4ip UTSW 2 137068347 utr 3 prime probably benign
R4944:Slx4ip UTSW 2 137046767 missense probably benign 0.17
R5061:Slx4ip UTSW 2 137044010 missense probably damaging 1.00
R5465:Slx4ip UTSW 2 137004947 missense probably damaging 1.00
R5609:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R6112:Slx4ip UTSW 2 137046744 missense probably damaging 1.00
R6391:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R6525:Slx4ip UTSW 2 137000218 missense possibly damaging 0.72
R6868:Slx4ip UTSW 2 137000210 missense probably damaging 1.00
R6944:Slx4ip UTSW 2 137068275 missense probably damaging 1.00
R6966:Slx4ip UTSW 2 137068224 missense probably damaging 0.96
R7214:Slx4ip UTSW 2 137046730 missense probably benign 0.15
R7406:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGATAACATTGCTCTCTCCAC -3'
(R):5'- AGTGCATTGTGGTCCAGCTC -3'

Sequencing Primer
(F):5'- CCACTCATATGAAGTCTCTGTTGG -3'
(R):5'- AGTATTCTGGGAGTTCTGGA -3'
Posted On2014-10-16