Incidental Mutation 'R2263:Nell1'
ID243922
Institutional Source Beutler Lab
Gene Symbol Nell1
Ensembl Gene ENSMUSG00000055409
Gene NameNEL-like 1
SynonymsB230343H07Rik, l7R6
MMRRC Submission 040263-MU
Accession Numbers

Genbank: NM_001037906; MGI: 2443902

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2263 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49974864-50866608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50560821 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 494 (T494I)
Ref Sequence ENSEMBL: ENSMUSP00000103229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]
Predicted Effect probably benign
Transcript: ENSMUST00000081872
AA Change: T494I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: T494I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_CA 549 595 1.08e-10 SMART
EGF_like 596 635 1.84e-4 SMART
VWC 634 686 1.42e0 SMART
VWC 694 749 1.83e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107603
AA Change: T494I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: T494I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_like 549 588 1.84e-4 SMART
VWC 587 639 1.42e0 SMART
VWC 647 702 1.83e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136672
Predicted Effect unknown
Transcript: ENSMUST00000151721
AA Change: P357S
SMART Domains Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409
AA Change: P357S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152166
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (57/58)
MGI Phenotype Strain: 3626314
Lethality: E19-E21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T C 7: 29,532,562 noncoding transcript Het
9130011E15Rik A G 19: 45,932,349 probably null Het
Abca13 T C 11: 9,274,702 S472P probably benign Het
Arsi T C 18: 60,916,665 Y207H probably damaging Het
Atp2b4 C T 1: 133,726,533 R778Q probably benign Het
Bdp1 T A 13: 100,066,037 D693V probably damaging Het
Car12 C A 9: 66,747,631 Y114* probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a1 A G 8: 11,312,586 probably benign Het
Cryl1 G T 14: 57,286,408 Y232* probably null Het
Dnah11 T A 12: 117,880,025 M4362L probably benign Het
Dnah11 T C 12: 117,966,639 T3324A probably damaging Het
Dnah8 A G 17: 30,673,835 N798S probably damaging Het
Dok4 A T 8: 94,866,512 C182S probably damaging Het
Ehbp1 A T 11: 22,095,462 N737K probably benign Het
Eif2b4 T C 5: 31,192,574 probably benign Het
Fat4 T C 3: 38,888,989 V677A possibly damaging Het
Fbn2 A G 18: 58,095,176 probably benign Het
Fbxl3 G T 14: 103,083,212 Y314* probably null Het
Fgf12 T A 16: 28,189,611 K84* probably null Het
Flt3 G A 5: 147,348,063 P748L probably benign Het
Folh1 C T 7: 86,719,765 S685N probably benign Het
Gm13119 A G 4: 144,363,541 I384V probably benign Het
Gpr65 A T 12: 98,275,235 N49I probably damaging Het
Hdac7 A G 15: 97,810,851 probably null Het
Heatr5a A T 12: 51,916,150 V989E probably damaging Het
Ikbkap A G 4: 56,755,298 probably null Het
Kif12 A G 4: 63,169,521 S242P probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Mia3 A G 1: 183,334,793 Y295H probably benign Het
Nmur2 A T 11: 56,029,561 V286E probably damaging Het
Olfr1378 G A 11: 50,969,869 V284I possibly damaging Het
Olfr20 T A 11: 73,354,305 L184Q possibly damaging Het
Olfr574 T C 7: 102,949,257 F254S probably damaging Het
Pcdh1 A T 18: 38,198,657 L431H probably benign Het
Prex1 A T 2: 166,589,068 probably benign Het
Prim1 T A 10: 128,015,263 D5E probably benign Het
Rubcnl A T 14: 75,040,820 N348I possibly damaging Het
Shisa9 G T 16: 11,984,767 A63S possibly damaging Het
Shpk G A 11: 73,206,493 probably benign Het
Slx4ip T C 2: 137,044,015 I85T probably damaging Het
Sptbn4 T A 7: 27,434,357 D77V probably damaging Het
Strn3 A T 12: 51,643,223 probably null Het
Synrg T C 11: 83,977,152 M61T possibly damaging Het
Tekt4 T A 17: 25,476,511 S439R possibly damaging Het
Ticam1 A T 17: 56,271,888 V69E possibly damaging Het
Trpv1 C T 11: 73,241,682 A374V probably damaging Het
Ubqln3 A T 7: 104,141,635 L416* probably null Het
Uqcrfs1 G A 13: 30,541,107 S150L probably benign Het
Utp15 T C 13: 98,257,925 N153S probably benign Het
Vmn2r63 G T 7: 42,928,607 T169N probably benign Het
Vps13b T A 15: 35,646,181 V1477E probably benign Het
Xpo1 T A 11: 23,284,634 probably null Het
Xpo5 A G 17: 46,230,343 I769V probably benign Het
Zc3h14 A T 12: 98,758,514 H252L probably benign Het
Zfp410 G T 12: 84,323,020 probably null Het
Zfp521 T C 18: 13,846,240 E372G possibly damaging Het
Other mutations in Nell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nell1 APN 7 50120673 missense probably damaging 0.96
IGL01434:Nell1 APN 7 50701208 missense probably benign 0.01
IGL01796:Nell1 APN 7 50176216 splice site probably benign
IGL02048:Nell1 APN 7 50219607 missense probably damaging 0.96
IGL02239:Nell1 APN 7 50249650 missense probably benign 0.08
IGL02860:Nell1 APN 7 50848485 missense probably damaging 0.99
IGL02958:Nell1 APN 7 50220337 critical splice donor site probably null
IGL03143:Nell1 APN 7 50279533 nonsense probably null
IGL03334:Nell1 APN 7 50062611 splice site probably null
D6062:Nell1 UTSW 7 50258191 missense probably benign 0.21
P0018:Nell1 UTSW 7 50120691 missense probably damaging 1.00
R0004:Nell1 UTSW 7 50560759 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0468:Nell1 UTSW 7 50228846 missense probably damaging 0.97
R0483:Nell1 UTSW 7 50230180 missense probably benign 0.07
R0732:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R0945:Nell1 UTSW 7 50219585 missense probably benign 0.07
R1022:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1024:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1075:Nell1 UTSW 7 50853840 missense probably damaging 0.98
R1291:Nell1 UTSW 7 50230250 missense probably benign 0.00
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1634:Nell1 UTSW 7 50848558 missense possibly damaging 0.82
R1928:Nell1 UTSW 7 50701195 missense possibly damaging 0.51
R2060:Nell1 UTSW 7 50560830 missense possibly damaging 0.58
R2261:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2262:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2448:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R2869:Nell1 UTSW 7 50249657 intron probably benign
R2870:Nell1 UTSW 7 50249657 intron probably benign
R2871:Nell1 UTSW 7 50249657 intron probably benign
R3498:Nell1 UTSW 7 50258179 missense possibly damaging 0.55
R4044:Nell1 UTSW 7 50219619 missense probably damaging 1.00
R4623:Nell1 UTSW 7 50120562 missense possibly damaging 0.84
R4732:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4733:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4941:Nell1 UTSW 7 50062638 missense probably benign 0.10
R4942:Nell1 UTSW 7 50120649 missense possibly damaging 0.84
R5233:Nell1 UTSW 7 50176314 missense probably damaging 0.99
R5590:Nell1 UTSW 7 50279611 missense probably damaging 1.00
R5673:Nell1 UTSW 7 50228846 missense probably damaging 0.99
R5741:Nell1 UTSW 7 50560890 unclassified probably null
R6345:Nell1 UTSW 7 49975423 missense possibly damaging 0.91
R6916:Nell1 UTSW 7 50701179 missense probably benign 0.00
R7051:Nell1 UTSW 7 50448844 missense unknown
R7302:Nell1 UTSW 7 50856269 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAAATTCACCAACACCGTG -3'
(R):5'- GCTATGTTCAGCTCCCATAGTGAC -3'

Sequencing Primer
(F):5'- TTCACCAACACCGTGATTGAG -3'
(R):5'- TGTTCAGCTCCCATAGTGACAACAG -3'
Posted On2014-10-16