Incidental Mutation 'R2264:Aatk'
ID244012
Institutional Source Beutler Lab
Gene Symbol Aatk
Ensembl Gene ENSMUSG00000025375
Gene Nameapoptosis-associated tyrosine kinase
SynonymsAATYK1
MMRRC Submission 040264-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R2264 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120007313-120047167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120010274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1042 (S1042P)
Ref Sequence ENSEMBL: ENSMUSP00000099309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020] [ENSMUST00000106233]
Predicted Effect probably benign
Transcript: ENSMUST00000026436
SMART Domains Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 6e-101 PFAM
PDB:4JS0|B 261 292 2e-13 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064307
AA Change: S1099P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: S1099P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 49 N/A INTRINSIC
Pfam:Pkinase_Tyr 135 405 3.9e-63 PFAM
Pfam:Pkinase 136 404 2.6e-33 PFAM
low complexity region 425 457 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 615 624 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
low complexity region 808 819 N/A INTRINSIC
low complexity region 913 927 N/A INTRINSIC
low complexity region 934 943 N/A INTRINSIC
low complexity region 985 1004 N/A INTRINSIC
low complexity region 1063 1082 N/A INTRINSIC
low complexity region 1085 1096 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
low complexity region 1179 1204 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083666
Predicted Effect probably damaging
Transcript: ENSMUST00000103019
AA Change: S1042P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: S1042P

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103020
AA Change: S1042P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: S1042P

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106233
SMART Domains Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372

DomainStartEndE-ValueType
Pfam:IMD 17 237 1.6e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198674
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc1 C T 3: 19,134,869 V211I probably damaging Het
Asna1 G A 8: 85,025,258 probably benign Het
B4galnt3 T C 6: 120,203,810 *986W probably null Het
BC024139 T A 15: 76,125,917 D105V probably damaging Het
BC049715 C T 6: 136,840,436 Q225* probably null Het
Cadps2 T C 6: 23,323,340 H1043R probably benign Het
Casc1 A G 6: 145,208,429 probably benign Het
Ccdc42 T C 11: 68,587,651 V33A probably benign Het
Cldn1 A G 16: 26,359,199 Y159H probably damaging Het
Cog6 A T 3: 52,992,911 C476* probably null Het
Col14a1 T G 15: 55,466,690 probably null Het
Crisp1 C T 17: 40,313,074 M1I probably null Het
Dip2b T A 15: 100,203,216 S1297T probably benign Het
Dlgap4 A G 2: 156,701,463 E262G probably benign Het
Dpp4 A C 2: 62,378,239 V187G possibly damaging Het
F5 A G 1: 164,194,402 D1482G probably benign Het
Fads6 T A 11: 115,286,235 T132S probably damaging Het
Fat4 A G 3: 38,890,422 I1155V probably benign Het
Fermt1 C T 2: 132,915,190 probably null Het
Fstl1 C T 16: 37,777,291 probably benign Het
Gm5089 T C 14: 122,436,102 Y69C unknown Het
Gm9871 T C 6: 101,796,240 noncoding transcript Het
Gpr89 A G 3: 96,872,515 S375P probably damaging Het
Gtf2h4 A G 17: 35,668,664 probably benign Het
Gtsf1 T A 15: 103,419,964 N148I possibly damaging Het
Hexa T C 9: 59,555,377 S129P probably damaging Het
Iigp1 A T 18: 60,390,666 E285D probably benign Het
Il23r T A 6: 67,426,667 probably null Het
Iqch T C 9: 63,512,299 K463R probably benign Het
Kcnd1 A G X: 7,824,084 probably null Het
Kif26b A T 1: 178,928,842 probably null Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Lrp2 T C 2: 69,482,366 D2526G possibly damaging Het
Map4 G T 9: 110,081,457 G851C probably damaging Het
Mtmr11 A T 3: 96,169,097 E456V possibly damaging Het
Muc13 G A 16: 33,808,039 probably null Het
Myo18a C A 11: 77,819,972 probably benign Het
Nphp4 T A 4: 152,503,008 probably benign Het
Nrg3 T C 14: 38,381,702 E445G probably damaging Het
Ntrk1 A G 3: 87,779,634 probably null Het
Olfr906 G T 9: 38,488,055 V9L possibly damaging Het
Parp6 T C 9: 59,624,005 S57P probably damaging Het
Pcdhb12 A G 18: 37,436,805 N335D probably damaging Het
Pdzph1 T C 17: 58,888,167 probably null Het
Pea15a C T 1: 172,199,137 R79H probably benign Het
Pik3ca A C 3: 32,437,927 I225L possibly damaging Het
Pim3 T A 15: 88,864,590 I270N probably damaging Het
Pkd1l1 T A 11: 8,879,112 R1043S probably damaging Het
Plekhg6 A G 6: 125,377,468 S70P probably benign Het
Ptpn13 T A 5: 103,489,661 D138E possibly damaging Het
Rap1gap T C 4: 137,727,723 L354P probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sf3a1 T A 11: 4,177,443 S590T probably benign Het
Slc14a2 T C 18: 78,163,089 probably benign Het
Slfn3 T G 11: 83,212,972 I223S probably benign Het
Smarca1 C T X: 47,875,283 V331I probably benign Het
Soat1 A G 1: 156,437,697 probably benign Het
Tinagl1 A G 4: 130,167,433 V308A probably benign Het
Tomm22 T A 15: 79,671,287 Y78N probably damaging Het
Ttll1 T C 15: 83,496,408 Y252C probably damaging Het
Ttn C T 2: 76,793,130 V15368I probably benign Het
Ubr4 T C 4: 139,420,373 probably benign Het
Wbp2 T C 11: 116,079,598 probably null Het
Xkr7 A T 2: 153,054,257 I344F probably damaging Het
Zfp947 A T 17: 22,145,938 C252S probably benign Het
Other mutations in Aatk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Aatk APN 11 120010186 missense probably benign 0.02
IGL00953:Aatk APN 11 120011221 missense probably benign 0.00
IGL01019:Aatk APN 11 120012275 missense probably benign
IGL01758:Aatk APN 11 120010819 missense possibly damaging 0.86
IGL02377:Aatk APN 11 120046863 utr 5 prime probably benign
IGL02902:Aatk APN 11 120011777 missense probably benign 0.00
IGL03067:Aatk APN 11 120010083 missense probably benign 0.00
IGL03116:Aatk APN 11 120016751 missense probably benign 0.14
IGL03279:Aatk APN 11 120013678 missense probably damaging 1.00
IGL03405:Aatk APN 11 120016403 missense probably benign 0.02
R0101:Aatk UTSW 11 120010913 missense probably benign 0.19
R0497:Aatk UTSW 11 120018780 missense probably damaging 0.99
R0535:Aatk UTSW 11 120010193 missense probably benign 0.00
R0638:Aatk UTSW 11 120009922 missense probably damaging 1.00
R0939:Aatk UTSW 11 120012143 missense probably damaging 0.99
R1475:Aatk UTSW 11 120010888 missense probably damaging 0.96
R1840:Aatk UTSW 11 120013732 missense probably damaging 1.00
R1865:Aatk UTSW 11 120010222 missense probably benign 0.00
R1982:Aatk UTSW 11 120013514 missense probably damaging 1.00
R2027:Aatk UTSW 11 120009317 missense probably damaging 1.00
R2115:Aatk UTSW 11 120009736 missense probably benign
R2220:Aatk UTSW 11 120012177 missense probably damaging 1.00
R2504:Aatk UTSW 11 120018855 missense probably benign 0.00
R3872:Aatk UTSW 11 120010219 missense possibly damaging 0.71
R4551:Aatk UTSW 11 120011569 missense probably benign 0.03
R4657:Aatk UTSW 11 120013478 missense possibly damaging 0.69
R4744:Aatk UTSW 11 120016122 missense possibly damaging 0.64
R4924:Aatk UTSW 11 120011525 missense probably damaging 1.00
R5063:Aatk UTSW 11 120010489 missense probably benign 0.07
R5223:Aatk UTSW 11 120013452 missense possibly damaging 0.95
R5243:Aatk UTSW 11 120016768 missense probably damaging 1.00
R5376:Aatk UTSW 11 120012034 missense probably damaging 0.98
R5442:Aatk UTSW 11 120018768 missense probably benign 0.02
R5550:Aatk UTSW 11 120009303 missense probably benign 0.42
R5678:Aatk UTSW 11 120010154 missense probably benign 0.00
R5932:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6026:Aatk UTSW 11 120012364 missense possibly damaging 0.65
R6129:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6409:Aatk UTSW 11 120011732 missense probably benign 0.01
R6477:Aatk UTSW 11 120018870 missense probably benign 0.00
R6478:Aatk UTSW 11 120010991 missense probably benign 0.00
R6749:Aatk UTSW 11 120010774 missense possibly damaging 0.58
R6753:Aatk UTSW 11 120010151 missense probably benign
R6787:Aatk UTSW 11 120010682 missense probably damaging 1.00
R6852:Aatk UTSW 11 120010468 missense probably benign 0.10
X0064:Aatk UTSW 11 120011176 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TAGATTTCGGGCACTCTGGC -3'
(R):5'- GATCCAGGACTCCCAAAAGG -3'

Sequencing Primer
(F):5'- CGGAGCTCCTCATCAGACTC -3'
(R):5'- AGACCTGAGGAGCCCACCTAG -3'
Posted On2014-10-16