Incidental Mutation 'R2264:Slc14a2'
ID244031
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
MMRRC Submission 040264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2264 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 78163089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434]
Predicted Effect probably benign
Transcript: ENSMUST00000025434
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,010,274 S1042P probably damaging Het
Armc1 C T 3: 19,134,869 V211I probably damaging Het
Asna1 G A 8: 85,025,258 probably benign Het
B4galnt3 T C 6: 120,203,810 *986W probably null Het
BC024139 T A 15: 76,125,917 D105V probably damaging Het
BC049715 C T 6: 136,840,436 Q225* probably null Het
Cadps2 T C 6: 23,323,340 H1043R probably benign Het
Casc1 A G 6: 145,208,429 probably benign Het
Ccdc42 T C 11: 68,587,651 V33A probably benign Het
Cldn1 A G 16: 26,359,199 Y159H probably damaging Het
Cog6 A T 3: 52,992,911 C476* probably null Het
Col14a1 T G 15: 55,466,690 probably null Het
Crisp1 C T 17: 40,313,074 M1I probably null Het
Dip2b T A 15: 100,203,216 S1297T probably benign Het
Dlgap4 A G 2: 156,701,463 E262G probably benign Het
Dpp4 A C 2: 62,378,239 V187G possibly damaging Het
F5 A G 1: 164,194,402 D1482G probably benign Het
Fads6 T A 11: 115,286,235 T132S probably damaging Het
Fat4 A G 3: 38,890,422 I1155V probably benign Het
Fermt1 C T 2: 132,915,190 probably null Het
Fstl1 C T 16: 37,777,291 probably benign Het
Gm5089 T C 14: 122,436,102 Y69C unknown Het
Gm9871 T C 6: 101,796,240 noncoding transcript Het
Gpr89 A G 3: 96,872,515 S375P probably damaging Het
Gtf2h4 A G 17: 35,668,664 probably benign Het
Gtsf1 T A 15: 103,419,964 N148I possibly damaging Het
Hexa T C 9: 59,555,377 S129P probably damaging Het
Iigp1 A T 18: 60,390,666 E285D probably benign Het
Il23r T A 6: 67,426,667 probably null Het
Iqch T C 9: 63,512,299 K463R probably benign Het
Kcnd1 A G X: 7,824,084 probably null Het
Kif26b A T 1: 178,928,842 probably null Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Lrp2 T C 2: 69,482,366 D2526G possibly damaging Het
Map4 G T 9: 110,081,457 G851C probably damaging Het
Mtmr11 A T 3: 96,169,097 E456V possibly damaging Het
Muc13 G A 16: 33,808,039 probably null Het
Myo18a C A 11: 77,819,972 probably benign Het
Nphp4 T A 4: 152,503,008 probably benign Het
Nrg3 T C 14: 38,381,702 E445G probably damaging Het
Ntrk1 A G 3: 87,779,634 probably null Het
Olfr906 G T 9: 38,488,055 V9L possibly damaging Het
Parp6 T C 9: 59,624,005 S57P probably damaging Het
Pcdhb12 A G 18: 37,436,805 N335D probably damaging Het
Pdzph1 T C 17: 58,888,167 probably null Het
Pea15a C T 1: 172,199,137 R79H probably benign Het
Pik3ca A C 3: 32,437,927 I225L possibly damaging Het
Pim3 T A 15: 88,864,590 I270N probably damaging Het
Pkd1l1 T A 11: 8,879,112 R1043S probably damaging Het
Plekhg6 A G 6: 125,377,468 S70P probably benign Het
Ptpn13 T A 5: 103,489,661 D138E possibly damaging Het
Rap1gap T C 4: 137,727,723 L354P probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sf3a1 T A 11: 4,177,443 S590T probably benign Het
Slfn3 T G 11: 83,212,972 I223S probably benign Het
Smarca1 C T X: 47,875,283 V331I probably benign Het
Soat1 A G 1: 156,437,697 probably benign Het
Tinagl1 A G 4: 130,167,433 V308A probably benign Het
Tomm22 T A 15: 79,671,287 Y78N probably damaging Het
Ttll1 T C 15: 83,496,408 Y252C probably damaging Het
Ttn C T 2: 76,793,130 V15368I probably benign Het
Ubr4 T C 4: 139,420,373 probably benign Het
Wbp2 T C 11: 116,079,598 probably null Het
Xkr7 A T 2: 153,054,257 I344F probably damaging Het
Zfp947 A T 17: 22,145,938 C252S probably benign Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R3878:Slc14a2 UTSW 18 78159074 missense probably benign
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTGTCACTTGTTCTGGATTAC -3'
(R):5'- TCGTGCAAAGACTAACGCAG -3'

Sequencing Primer
(F):5'- TGGATTACTTCCCCAACAGCCG -3'
(R):5'- GCTGCTTGCAGATGGGAAC -3'
Posted On2014-10-16