Incidental Mutation 'R0277:Nfe2l3'
ID24405
Institutional Source Beutler Lab
Gene Symbol Nfe2l3
Ensembl Gene ENSMUSG00000029832
Gene Namenuclear factor, erythroid derived 2, like 3
SynonymsNrf3
MMRRC Submission 038499-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0277 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location51432670-51458768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51457468 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 336 (M336K)
Ref Sequence ENSEMBL: ENSMUSP00000005103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005103] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000160133] [ENSMUST00000203954] [ENSMUST00000204158]
Predicted Effect probably benign
Transcript: ENSMUST00000005103
AA Change: M336K

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005103
Gene: ENSMUSG00000029832
AA Change: M336K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
BRLZ 539 603 3.68e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069949
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090002
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160133
SMART Domains Protein: ENSMUSP00000124920
Gene: ENSMUSG00000029832

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203954
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204158
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204885
Meta Mutation Damage Score 0.0468 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.3%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cap 'n' collar basic-region leucine zipper family of transcription factors. The encoded protein heterodimerizes with small musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik A G 7: 125,318,643 K69R unknown Het
4932438A13Rik T A 3: 36,943,182 C1129* probably null Het
Abca13 A C 11: 9,294,701 D2188A probably benign Het
Acad11 T C 9: 104,124,025 M708T probably damaging Het
Adam7 T C 14: 68,510,857 probably null Het
Adgre1 T A 17: 57,444,060 I578N probably benign Het
Agbl4 T C 4: 111,617,222 S403P probably damaging Het
Ak3 A G 19: 29,047,792 M13T possibly damaging Het
Ap2s1 T C 7: 16,747,380 probably benign Het
Arhgef1 A T 7: 24,923,799 probably benign Het
Arsk T C 13: 76,074,932 N182S probably benign Het
Aspscr1 G A 11: 120,678,420 V15I probably damaging Het
Asxl2 A G 12: 3,442,487 Y24C probably damaging Het
Atp8b1 A G 18: 64,568,252 F345S possibly damaging Het
Atp8b3 T C 10: 80,526,909 K672E probably benign Het
Bmp2k A G 5: 97,087,823 probably benign Het
Casp6 T A 3: 129,910,523 V86E probably benign Het
Cdca5 A G 19: 6,090,712 E260G unknown Het
Cpb2 T A 14: 75,265,458 V159D probably damaging Het
Cylc2 T A 4: 51,228,477 S183T unknown Het
Dhtkd1 T A 2: 5,914,888 M561L probably benign Het
Dync2h1 T C 9: 7,129,046 D1823G probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Erc1 T C 6: 119,620,328 K1003E probably damaging Het
Ezr G A 17: 6,754,765 Q105* probably null Het
Fam83d T A 2: 158,785,547 D385E probably benign Het
Fbn2 A G 18: 58,045,317 C1950R probably damaging Het
Fbxo32 A T 15: 58,184,209 I236N probably damaging Het
Fcgbp G T 7: 28,085,493 probably null Het
Foxe3 T C 4: 114,925,608 N136D probably damaging Het
Fscn2 A T 11: 120,368,011 I461F probably damaging Het
Gldc A G 19: 30,116,451 I722T possibly damaging Het
Gm10717 T G 9: 3,025,619 V68G possibly damaging Het
Gm4841 A G 18: 60,270,646 L125S possibly damaging Het
Gnl3 A C 14: 31,013,427 probably null Het
Gsto1 A T 19: 47,857,977 I88F probably damaging Het
Gucy1b1 T A 3: 82,038,156 probably null Het
Hhla1 C A 15: 65,948,503 V133F probably benign Het
Hipk3 T A 2: 104,441,248 L446F probably damaging Het
Hscb T C 5: 110,834,690 E177G possibly damaging Het
Hsd17b6 T C 10: 127,991,405 D266G probably benign Het
Ipo4 T C 14: 55,632,115 S363G probably benign Het
Kcnip3 A G 2: 127,459,979 probably benign Het
Klhl41 A G 2: 69,671,296 Y367C probably damaging Het
Klk1b4 C G 7: 44,211,629 P232R possibly damaging Het
Lcp2 A G 11: 34,054,322 D53G probably damaging Het
Llgl2 A G 11: 115,850,720 K559E probably damaging Het
Lrrc59 A C 11: 94,643,422 T269P probably damaging Het
Mark1 A G 1: 184,944,952 S34P possibly damaging Het
Megf11 G A 9: 64,691,350 probably null Het
Mplkip A G 13: 17,696,980 I159V possibly damaging Het
Muc4 C A 16: 32,755,690 probably benign Het
Myo18b A G 5: 112,693,347 probably benign Het
Myo9b T C 8: 71,355,952 probably benign Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg3 A G 2: 156,934,935 probably benign Het
Nrxn1 A C 17: 90,700,742 probably null Het
Nsun3 A T 16: 62,776,644 probably benign Het
Nuak1 T C 10: 84,374,451 E591G probably benign Het
Olfr1347 T A 7: 6,488,434 M147L probably benign Het
Olfr1511 T C 14: 52,390,389 Y128C probably damaging Het
Olfr215 A T 6: 116,582,601 V115E probably damaging Het
Olfr23 A T 11: 73,940,947 I234F probably benign Het
Olfr730 T C 14: 50,186,332 N296S probably null Het
Olfr814 T A 10: 129,874,067 Q230L probably damaging Het
Olfr982 G A 9: 40,074,714 V140I probably benign Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Ovgp1 T C 3: 105,979,892 probably benign Het
Palm3 T A 8: 84,028,720 V287D probably damaging Het
Pde4dip T A 3: 97,843,712 H62L probably benign Het
Pdk4 G T 6: 5,491,620 P100Q probably damaging Het
Pdss2 T A 10: 43,372,176 H225Q probably benign Het
Pkhd1 A T 1: 20,275,538 D2755E probably benign Het
Prune2 A T 19: 17,121,389 D1419V probably damaging Het
Pth2r A C 1: 65,388,616 I483L probably benign Het
Qrsl1 A G 10: 43,896,007 probably null Het
Rab11fip4 A G 11: 79,686,629 H403R possibly damaging Het
Ralgapa1 A T 12: 55,677,238 I1548N probably damaging Het
Ric8a T G 7: 140,857,900 probably benign Het
Rsbn1 T C 3: 103,914,581 F44S possibly damaging Het
Serpinc1 T A 1: 160,989,702 M1K probably null Het
Sf3b1 T C 1: 55,019,257 I58V probably damaging Het
Sh3d19 T A 3: 86,126,671 M777K probably benign Het
Sipa1 A T 19: 5,654,065 M743K probably benign Het
Skint5 T C 4: 113,937,621 H255R probably benign Het
Slco6b1 A T 1: 96,988,673 noncoding transcript Het
Slfn4 A T 11: 83,186,951 R188S probably damaging Het
Sort1 T C 3: 108,324,592 probably benign Het
Spg21 A T 9: 65,465,347 K20N possibly damaging Het
Sptbn2 A T 19: 4,745,145 I1544F probably benign Het
Srf T C 17: 46,549,489 T456A possibly damaging Het
Ssbp2 T A 13: 91,564,596 probably benign Het
Stx2 C T 5: 128,988,903 V230I probably benign Het
Sv2b A T 7: 75,206,439 D34E possibly damaging Het
Synpo2l A G 14: 20,661,788 S255P probably damaging Het
Tbx15 C T 3: 99,352,391 P526L probably damaging Het
Tenm4 C A 7: 96,694,950 P250Q possibly damaging Het
Tgm1 C A 14: 55,710,927 probably benign Het
Tgm1 T C 14: 55,712,652 probably benign Het
Thsd7b A G 1: 130,195,263 I1540V probably benign Het
Tnrc6c A G 11: 117,739,881 K1023E probably damaging Het
Ube2l6 A T 2: 84,806,427 probably null Het
Uty T A Y: 1,169,979 I326F probably damaging Het
Wdfy4 T C 14: 33,083,785 D1735G possibly damaging Het
Wnt11 A G 7: 98,847,383 K177E probably damaging Het
Wnt5a A T 14: 28,513,268 M70L possibly damaging Het
Wwc1 T A 11: 35,852,348 E882V probably damaging Het
Zfp455 G T 13: 67,198,664 probably null Het
Zmpste24 A G 4: 121,082,853 Y199H probably damaging Het
Other mutations in Nfe2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02705:Nfe2l3 APN 6 51433118 missense probably damaging 0.96
IGL02803:Nfe2l3 APN 6 51457311 missense possibly damaging 0.50
R0693:Nfe2l3 UTSW 6 51433054 missense possibly damaging 0.94
R1397:Nfe2l3 UTSW 6 51433294 missense probably benign 0.00
R1455:Nfe2l3 UTSW 6 51457764 missense possibly damaging 0.91
R1541:Nfe2l3 UTSW 6 51457605 missense probably damaging 0.98
R1753:Nfe2l3 UTSW 6 51433412 missense probably null 0.96
R1946:Nfe2l3 UTSW 6 51457315 missense probably damaging 1.00
R2034:Nfe2l3 UTSW 6 51458370 missense possibly damaging 0.50
R3807:Nfe2l3 UTSW 6 51457377 nonsense probably null
R3932:Nfe2l3 UTSW 6 51456615 missense possibly damaging 0.94
R4271:Nfe2l3 UTSW 6 51456634 missense probably damaging 0.99
R4604:Nfe2l3 UTSW 6 51451012 missense probably damaging 0.99
R4816:Nfe2l3 UTSW 6 51456624 missense probably damaging 0.99
R5765:Nfe2l3 UTSW 6 51457246 missense probably damaging 1.00
R5893:Nfe2l3 UTSW 6 51457852 missense probably damaging 1.00
R7378:Nfe2l3 UTSW 6 51457296 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCAGGGCATCTCAGTGGAAGAC -3'
(R):5'- CCATGCAAAAGATTCAGATGTGGGC -3'

Sequencing Primer
(F):5'- GGAAGACATTCCACCTTTTCTGAG -3'
(R):5'- CTGATGCACCTGACTGTAAATGG -3'
Posted On2013-04-16