Incidental Mutation 'R2265:Ddx4'
ID244109
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
SynonymsMvh, VASA, mvh / m'vasa
MMRRC Submission 040265-MU
Accession Numbers

Genbank: NM_001145885, NM_010029

Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R2265 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112598333-112652475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112621276 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 290 (Y290H)
Ref Sequence ENSEMBL: ENSMUSP00000075157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
Predicted Effect probably benign
Transcript: ENSMUST00000075748
AA Change: Y290H

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: Y290H

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099166
AA Change: Y316H

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: Y316H

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A G X: 18,423,687 S179P possibly damaging Het
A830018L16Rik T C 1: 11,972,104 probably null Het
Aadac T A 3: 60,037,316 D136E probably damaging Het
Abca16 A G 7: 120,431,160 D165G probably benign Het
Adam24 T A 8: 40,680,071 S193T possibly damaging Het
Adra2b T C 2: 127,363,871 S103P probably damaging Het
Agrn C T 4: 156,179,218 G173R probably damaging Het
Alg11 T A 8: 22,065,614 V255E probably benign Het
Aox1 C A 1: 58,081,520 D857E probably damaging Het
Apob T C 12: 8,015,475 F4115S possibly damaging Het
Bdkrb2 A G 12: 105,592,225 T242A probably benign Het
Cdca7 T C 2: 72,482,490 L190P probably benign Het
Cenpe A G 3: 135,261,636 T2180A probably benign Het
Cep41 T A 6: 30,660,916 I126F possibly damaging Het
Col16a1 C A 4: 130,052,918 H111Q probably benign Het
Cops3 T C 11: 59,827,890 T193A probably benign Het
Dbr1 G A 9: 99,579,410 V153M probably damaging Het
Dgkb T A 12: 38,190,108 S461R possibly damaging Het
Dnajc28 T C 16: 91,616,312 N372S probably benign Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dock3 C A 9: 106,941,326 V1190F probably damaging Het
Exosc1 A G 19: 41,931,418 S54P probably damaging Het
Fbxw22 C T 9: 109,383,994 R295K probably benign Het
Foxo1 T C 3: 52,345,912 S499P probably benign Het
Heatr5a T C 12: 51,893,745 D1444G possibly damaging Het
Hspa2 T G 12: 76,406,188 I552S probably benign Het
Imp4 T A 1: 34,443,847 I173N probably damaging Het
Itgal A G 7: 127,306,701 I352V possibly damaging Het
Kcnh6 G A 11: 106,033,817 R816Q probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnip3 G T 2: 127,465,061 A173D probably benign Het
Kir3dl1 A G X: 136,525,035 R53G probably benign Het
Klhl31 A G 9: 77,650,158 D52G possibly damaging Het
Klk1b21 T C 7: 44,104,439 I49T possibly damaging Het
Lama2 T A 10: 26,992,936 I2838F probably damaging Het
Lilrb4a T A 10: 51,491,537 Y58* probably null Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mpdz A G 4: 81,383,391 S266P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 T C 4: 106,720,927 N185D probably benign Het
Mybphl A G 3: 108,365,001 E2G probably damaging Het
Mycbp2 T C 14: 103,262,749 D937G probably benign Het
Myo18b A G 5: 112,782,673 M1799T probably damaging Het
Nr4a2 T A 2: 57,112,006 D145V possibly damaging Het
Ntmt1 C A 2: 30,820,460 N58K probably benign Het
Olfr1066 T C 2: 86,456,214 Y19C possibly damaging Het
Olfr1278 A G 2: 111,293,179 T304A probably benign Het
Olfr1330 A T 4: 118,893,874 R264W probably damaging Het
Olfr164 A G 16: 19,286,555 Y63H probably damaging Het
Olfr583 G A 7: 103,052,137 V280I probably benign Het
Olfr659 T C 7: 104,670,860 F53L probably benign Het
Ovch2 A T 7: 107,784,575 M521K probably damaging Het
P2ry13 T C 3: 59,210,028 M110V probably damaging Het
P2ry14 T C 3: 59,115,571 N165S probably damaging Het
Pcdhb19 A T 18: 37,497,683 H177L probably damaging Het
Phf8 T C X: 151,572,601 L520S possibly damaging Het
Pjvk T G 2: 76,657,453 S230A possibly damaging Het
Plch2 T C 4: 154,993,004 E423G probably benign Het
Rad9b T C 5: 122,351,342 Y41C probably damaging Het
Ranbp3l A T 15: 9,057,113 I286F probably damaging Het
Rtel1 T A 2: 181,354,368 V739D probably damaging Het
Slc35a3 T C 3: 116,673,636 K325E possibly damaging Het
Spag17 C A 3: 100,061,866 probably null Het
Spg11 A T 2: 122,108,307 C389S possibly damaging Het
Srsf4 T C 4: 131,897,682 V130A probably damaging Het
Taar8b T C 10: 24,091,372 N308S probably damaging Het
Tas2r117 T A 6: 132,803,225 C109S probably benign Het
Tlr5 T A 1: 182,975,035 S635T possibly damaging Het
Ttc21a G T 9: 119,959,008 C833F possibly damaging Het
Vash2 T C 1: 190,950,213 N347D probably damaging Het
Vcp G A 4: 42,980,833 A759V possibly damaging Het
Vmn2r18 T C 5: 151,586,662 E82G probably damaging Het
Vps13c T C 9: 67,920,947 V1461A possibly damaging Het
Zfp616 T C 11: 74,085,463 Y853H possibly damaging Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112624777 splice site probably benign
IGL02682:Ddx4 APN 13 112622186 missense probably benign 0.04
IGL02729:Ddx4 APN 13 112651412 utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112613833 splice site probably null
R0518:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R0521:Ddx4 UTSW 13 112624779 critical splice donor site probably null
R1527:Ddx4 UTSW 13 112622239 missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112599997 missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112599902 missense probably benign
R1886:Ddx4 UTSW 13 112622665 missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112620742 missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112600013 missense probably damaging 0.99
R2280:Ddx4 UTSW 13 112620656 missense probably benign 0.03
R2846:Ddx4 UTSW 13 112604612 missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112620777 splice site probably benign
R2980:Ddx4 UTSW 13 112612085 missense probably damaging 1.00
R3732:Ddx4 UTSW 13 112611982 missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4088:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4089:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4090:Ddx4 UTSW 13 112613761 missense probably benign 0.05
R4600:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112612060 missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112622244 missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112613696 critical splice donor site probably null
R4782:Ddx4 UTSW 13 112651360 missense probably benign 0.10
R5326:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112621245 missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112621232 nonsense probably null
R6253:Ddx4 UTSW 13 112636022 nonsense probably null
R6253:Ddx4 UTSW 13 112636023 missense probably benign 0.00
R6286:Ddx4 UTSW 13 112613735 missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112604547 missense probably benign
R6645:Ddx4 UTSW 13 112641174 missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112601488 missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112613785 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACCGTGAATCCTAATGATGG -3'
(R):5'- AGTTTAAGGTTCCCTCCAACAG -3'

Sequencing Primer
(F):5'- CCGTGAATCCTAATGATGGCTCAG -3'
(R):5'- CAGAGGATGTTTATGGAATGGTGAGC -3'
Posted On2014-10-16