Incidental Mutation 'R1387:Cacng8'
ID244124
Institutional Source Beutler Lab
Gene Symbol Cacng8
Ensembl Gene ENSMUSG00000053395
Gene Namecalcium channel, voltage-dependent, gamma subunit 8
SynonymsTARP gamma 8
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1387 (G1)
Quality Score54
Status Validated
Chromosome7
Chromosomal Location3390683-3415648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3415156 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 275 (S275P)
Ref Sequence ENSEMBL: ENSMUSP00000138618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092351] [ENSMUST00000182222]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092351
AA Change: S275P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090005
Gene: ENSMUSG00000053395
AA Change: S275P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 17 222 8.1e-41 PFAM
Pfam:Claudin_2 29 223 6.2e-22 PFAM
low complexity region 244 258 N/A INTRINSIC
low complexity region 261 287 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 316 360 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178285
Predicted Effect possibly damaging
Transcript: ENSMUST00000182222
AA Change: S275P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138618
Gene: ENSMUSG00000053395
AA Change: S275P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 17 222 8.1e-41 PFAM
Pfam:Claudin_2 29 223 6.8e-24 PFAM
low complexity region 244 258 N/A INTRINSIC
low complexity region 261 287 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 316 360 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type II TARP and a calcium channel gamma subunit. The mRNA for this gene is believed to initiate translation from a non-AUG (CUG) start codon. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted null mutations of this gene result in altered hippocampal AMPA receptor number, distribution and synaptic plasticity. Mice homozygous for one knock-out allele exhibit significantly impaired long term potentiation in hippocampal CA1 synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Pten G T 19: 32,798,096 A79S probably benign Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Cacng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0865:Cacng8 UTSW 7 3412109 missense possibly damaging 0.83
R1892:Cacng8 UTSW 7 3415052 missense possibly damaging 0.95
R3847:Cacng8 UTSW 7 3394474 missense probably damaging 1.00
R4763:Cacng8 UTSW 7 3414992 missense probably damaging 0.99
R4882:Cacng8 UTSW 7 3412153 missense probably damaging 1.00
R5085:Cacng8 UTSW 7 3415580 missense possibly damaging 0.96
R5497:Cacng8 UTSW 7 3415553 missense probably benign
R7034:Cacng8 UTSW 7 3415303 missense probably benign 0.00
R7036:Cacng8 UTSW 7 3415303 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGCCGTCAACATCTACATCGAG -3'
(R):5'- TTGTGCAGCGTGAGAAAACCCG -3'

Sequencing Primer
(F):5'- TCTACATCGAGCGCAGC -3'
(R):5'- TGAGAAAAcccgccgagc -3'
Posted On2014-10-17