Incidental Mutation 'R1412:Tex19.2'
ID244136
Institutional Source Beutler Lab
Gene Symbol Tex19.2
Ensembl Gene ENSMUSG00000039337
Gene Nametestis expressed gene 19.2
Synonyms4921530G04Rik, Tex19.2
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1412 (G1)
Quality Score78
Status Validated
Chromosome11
Chromosomal Location121116215-121118677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121116935 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 229 (V229A)
Ref Sequence ENSEMBL: ENSMUSP00000037027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039146
AA Change: V229A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037027
Gene: ENSMUSG00000039337
AA Change: V229A

DomainStartEndE-ValueType
Pfam:TEX19 1 145 7.2e-70 PFAM
low complexity region 184 196 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Double homozygous KO with Tex19.1 causes testis degeneration and male infertility owing to meiotic arrest in the germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Tex19.2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Tex19.2 APN 11 121116812 missense possibly damaging 0.93
R1828:Tex19.2 UTSW 11 121117491 missense probably benign 0.08
R3082:Tex19.2 UTSW 11 121116731 missense probably benign 0.01
R4902:Tex19.2 UTSW 11 121116956 missense probably damaging 0.99
R5486:Tex19.2 UTSW 11 121117478 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTGCCCTGCACATGAAGCTGAG -3'
(R):5'- ATTGTTGGAGTTGAGCCCCACC -3'

Sequencing Primer
(F):5'- ATGAAGCTGAGTCTAACCTTCCG -3'
(R):5'- CGCCATTTGCTACATGCTGT -3'
Posted On2014-10-28