Incidental Mutation 'R1195:Dnajc25'
ID244137
Institutional Source Beutler Lab
Gene Symbol Dnajc25
Ensembl Gene ENSMUSG00000070972
Gene NameDnaJ heat shock protein family (Hsp40) member C25
Synonyms2010203O07Rik, 2010109C08Rik
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1195 (G1)
Quality Score69
Status Validated
Chromosome4
Chromosomal Location58995062-59025573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59003415 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 62 (A62V)
Ref Sequence ENSEMBL: ENSMUSP00000114320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095070] [ENSMUST00000148366] [ENSMUST00000150309] [ENSMUST00000152199] [ENSMUST00000153467] [ENSMUST00000174664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095070
AA Change: A62V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092680
Gene: ENSMUSG00000070972
AA Change: A62V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 2.04e-19 SMART
low complexity region 125 138 N/A INTRINSIC
transmembrane domain 147 164 N/A INTRINSIC
coiled coil region 195 220 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148366
SMART Domains Protein: ENSMUSP00000116171
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150309
AA Change: A62V

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123172
Gene: ENSMUSG00000070972
AA Change: A62V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152199
SMART Domains Protein: ENSMUSP00000118048
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 28 45 N/A INTRINSIC
coiled coil region 76 101 N/A INTRINSIC
transmembrane domain 122 144 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153467
AA Change: A62V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114320
Gene: ENSMUSG00000070972
AA Change: A62V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 1.12e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174664
AA Change: A62V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134530
Gene: ENSMUSG00000092345
AA Change: A62V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 3.9e-16 SMART
G_gamma 94 150 1.06e-6 SMART
GGL 94 150 1.05e-9 SMART
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Msx1 A G 5: 37,821,281 Y297H probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sema5b A T 16: 35,651,660 E496V probably null Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Dnajc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Dnajc25 APN 4 59017693 nonsense probably null
R0505:Dnajc25 UTSW 4 59020438 missense possibly damaging 0.87
R2437:Dnajc25 UTSW 4 59020234 missense probably damaging 1.00
R5689:Dnajc25 UTSW 4 59017716 missense probably damaging 0.99
R6023:Dnajc25 UTSW 4 59013752 missense possibly damaging 0.53
R6329:Dnajc25 UTSW 4 59013678 missense probably benign 0.33
R7316:Dnajc25 UTSW 4 59017693 nonsense probably null
R7398:Dnajc25 UTSW 4 59017824 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGACCGCTGAGCTACTAAGACTACC -3'
(R):5'- GTGGGAAACGTGGACCTCCTAAAAG -3'

Sequencing Primer
(F):5'- AGGCTAAGGCGTCCTTCTC -3'
(R):5'- GTGGACCTCCTAAAAGTCCAGG -3'
Posted On2014-10-28