Incidental Mutation 'R2290:Cdh15'
ID244273
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Namecadherin 15
SynonymsM cadherin, Mcad, Cdh14
MMRRC Submission 040289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2290 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122847966-122867397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122859317 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 145 (N145I)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: N145I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: N145I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,527,313 D62G probably damaging Het
Ambp T C 4: 63,143,687 Y335C probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Asb13 G A 13: 3,649,418 G206D probably damaging Het
Ccdc7b A G 8: 129,131,106 probably benign Het
Celsr3 T C 9: 108,843,224 I2565T probably damaging Het
Cfap43 A T 19: 47,773,135 M840K probably damaging Het
Clip4 T C 17: 71,810,953 V331A possibly damaging Het
Cnnm1 A G 19: 43,491,502 T829A probably benign Het
Col24a1 G A 3: 145,513,195 G1457E probably damaging Het
D6Ertd527e A G 6: 87,111,545 N230S unknown Het
Dll1 T C 17: 15,374,748 D89G probably benign Het
Dst T A 1: 34,229,200 V2901E probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Efl1 A T 7: 82,777,670 K1125N probably damaging Het
Efr3a T A 15: 65,849,839 F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,926,942 probably benign Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Gm38999 A G 7: 43,427,699 E5G probably benign Het
Gm5828 C T 1: 16,768,344 noncoding transcript Het
Gnas T C 2: 174,300,010 F717L probably benign Het
H6pd T A 4: 149,981,881 S683C probably damaging Het
Il23r G A 6: 67,423,861 T495I probably benign Het
Itpr2 T C 6: 146,422,828 N135D probably damaging Het
Kcns2 T A 15: 34,838,509 L6Q possibly damaging Het
Khdrbs3 C T 15: 69,029,761 R132C probably damaging Het
Kif2b A G 11: 91,575,696 V587A probably benign Het
Kng1 A T 16: 23,079,125 H425L possibly damaging Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc8e T C 8: 4,231,770 M35T probably damaging Het
Med12l A G 3: 59,244,938 N1048S probably damaging Het
Mex3c A C 18: 73,590,693 N619T probably damaging Het
Mfsd4b1 G A 10: 40,003,331 T190I probably damaging Het
Ncam1 A G 9: 49,523,651 probably benign Het
Nlrp6 G A 7: 140,922,163 G133S probably damaging Het
Olfr1385 A G 11: 49,495,030 M166V probably benign Het
Olfr385 G T 11: 73,588,919 A273D probably benign Het
Olfr957 A G 9: 39,511,678 L14P possibly damaging Het
Olfr994 C T 2: 85,430,200 V210M possibly damaging Het
Oplah A G 15: 76,302,725 V630A probably benign Het
Papd5 T C 8: 88,251,975 S435P probably damaging Het
Pcnx2 A T 8: 125,877,595 probably benign Het
Pkhd1l1 A T 15: 44,528,250 T1571S probably benign Het
Pramef12 T A 4: 144,394,699 T252S probably benign Het
Pramef12 G T 4: 144,395,122 H111N probably benign Het
Prr22 T G 17: 56,771,884 F346V probably benign Het
Prr30 T C 14: 101,198,775 N117S possibly damaging Het
Ptgfrn A G 3: 101,077,361 S172P possibly damaging Het
Ptprc C T 1: 138,111,188 V364I probably benign Het
Ptprz1 T C 6: 23,000,991 S1027P probably damaging Het
Rinl T C 7: 28,792,271 V83A probably benign Het
Ros1 A T 10: 52,118,381 S1268T probably damaging Het
Scly T C 1: 91,298,450 probably null Het
Slc25a1 C T 16: 17,925,848 V186M possibly damaging Het
Stk36 T G 1: 74,626,144 probably benign Het
Syn2 A G 6: 115,274,229 T449A possibly damaging Het
Tecpr1 T C 5: 144,214,063 D309G probably damaging Het
Tns2 T A 15: 102,112,023 Y775N probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ttl G A 2: 129,081,270 G177D possibly damaging Het
Twf1 A G 15: 94,586,519 S41P probably damaging Het
Unc79 C T 12: 103,146,366 T2174M probably damaging Het
Vangl2 T A 1: 172,008,546 K340* probably null Het
Vmn2r72 T A 7: 85,738,341 T672S probably damaging Het
Vwa7 A G 17: 35,017,211 D47G probably damaging Het
Zc3h12d A G 10: 7,867,459 H331R probably benign Het
Zfa-ps T C 10: 52,545,016 noncoding transcript Het
Zfp141 A T 7: 42,475,225 C608S probably damaging Het
Zfp422 A G 6: 116,626,642 I132T possibly damaging Het
Zfp652 A G 11: 95,750,023 Y258C possibly damaging Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 122865323 intron probably benign
IGL01958:Cdh15 APN 8 122859350 missense probably damaging 1.00
IGL02588:Cdh15 APN 8 122856552 nonsense probably null
IGL02793:Cdh15 APN 8 122860982 missense probably damaging 1.00
IGL02947:Cdh15 APN 8 122865372 missense probably benign 0.00
R0310:Cdh15 UTSW 8 122865436 missense probably damaging 1.00
R0441:Cdh15 UTSW 8 122860966 missense probably damaging 1.00
R0766:Cdh15 UTSW 8 122861449 intron probably benign
R0898:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1023:Cdh15 UTSW 8 122865200 missense probably damaging 0.98
R1054:Cdh15 UTSW 8 122864337 missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R1081:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1101:Cdh15 UTSW 8 122860846 missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1209:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1210:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1312:Cdh15 UTSW 8 122861449 intron probably benign
R1317:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1318:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1393:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1428:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1429:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1695:Cdh15 UTSW 8 122862016 missense probably benign 0.05
R2157:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2170:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2178:Cdh15 UTSW 8 122864976 splice site probably null
R2252:Cdh15 UTSW 8 122857422 missense probably damaging 1.00
R2317:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2330:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2345:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2349:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2353:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2354:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2566:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2567:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2568:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2893:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2894:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2937:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2938:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2990:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2992:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2993:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3029:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3030:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3195:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R3441:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3442:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3608:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3686:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4119:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4120:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4477:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4478:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4480:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4580:Cdh15 UTSW 8 122865158 missense probably damaging 0.99
R4583:Cdh15 UTSW 8 122865028 missense probably damaging 0.98
R4619:Cdh15 UTSW 8 122860873 missense probably damaging 1.00
R4694:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4731:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R5076:Cdh15 UTSW 8 122864348 missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 122862063 missense probably null 1.00
R5375:Cdh15 UTSW 8 122865100 missense probably damaging 1.00
R5498:Cdh15 UTSW 8 122865178 missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 122856587 missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 122864347 missense probably benign 0.01
R6570:Cdh15 UTSW 8 122857391 missense probably damaging 1.00
R6708:Cdh15 UTSW 8 122863555 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AGCACACATTCCATCCCGTG -3'
(R):5'- GGATTGTCAATTCTGCCGC -3'

Sequencing Primer
(F):5'- GTGTGCTCCTCACCTGCG -3'
(R):5'- AGGATCCTGTCATGTCAAGC -3'
Posted On2014-10-30