Incidental Mutation 'R2290:Ncam1'
ID244279
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission 040289-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R2290 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 49523651 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000193547]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068730
Predicted Effect probably benign
Transcript: ENSMUST00000114476
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166811
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193547
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194252
Predicted Effect probably benign
Transcript: ENSMUST00000194844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216483
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,527,313 D62G probably damaging Het
Ambp T C 4: 63,143,687 Y335C probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Asb13 G A 13: 3,649,418 G206D probably damaging Het
Ccdc7b A G 8: 129,131,106 probably benign Het
Cdh15 A T 8: 122,859,317 N145I probably damaging Het
Celsr3 T C 9: 108,843,224 I2565T probably damaging Het
Cfap43 A T 19: 47,773,135 M840K probably damaging Het
Clip4 T C 17: 71,810,953 V331A possibly damaging Het
Cnnm1 A G 19: 43,491,502 T829A probably benign Het
Col24a1 G A 3: 145,513,195 G1457E probably damaging Het
D6Ertd527e A G 6: 87,111,545 N230S unknown Het
Dll1 T C 17: 15,374,748 D89G probably benign Het
Dst T A 1: 34,229,200 V2901E probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Efl1 A T 7: 82,777,670 K1125N probably damaging Het
Efr3a T A 15: 65,849,839 F437L probably benign Het
Eqtn GTTCTTCTTC GTTCTTC 4: 94,926,942 probably benign Het
Ermp1 T C 19: 29,623,778 D523G probably damaging Het
Gm38999 A G 7: 43,427,699 E5G probably benign Het
Gm5828 C T 1: 16,768,344 noncoding transcript Het
Gnas T C 2: 174,300,010 F717L probably benign Het
H6pd T A 4: 149,981,881 S683C probably damaging Het
Il23r G A 6: 67,423,861 T495I probably benign Het
Itpr2 T C 6: 146,422,828 N135D probably damaging Het
Kcns2 T A 15: 34,838,509 L6Q possibly damaging Het
Khdrbs3 C T 15: 69,029,761 R132C probably damaging Het
Kif2b A G 11: 91,575,696 V587A probably benign Het
Kng1 A T 16: 23,079,125 H425L possibly damaging Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc8e T C 8: 4,231,770 M35T probably damaging Het
Med12l A G 3: 59,244,938 N1048S probably damaging Het
Mex3c A C 18: 73,590,693 N619T probably damaging Het
Mfsd4b1 G A 10: 40,003,331 T190I probably damaging Het
Nlrp6 G A 7: 140,922,163 G133S probably damaging Het
Olfr1385 A G 11: 49,495,030 M166V probably benign Het
Olfr385 G T 11: 73,588,919 A273D probably benign Het
Olfr957 A G 9: 39,511,678 L14P possibly damaging Het
Olfr994 C T 2: 85,430,200 V210M possibly damaging Het
Oplah A G 15: 76,302,725 V630A probably benign Het
Papd5 T C 8: 88,251,975 S435P probably damaging Het
Pcnx2 A T 8: 125,877,595 probably benign Het
Pkhd1l1 A T 15: 44,528,250 T1571S probably benign Het
Pramef12 T A 4: 144,394,699 T252S probably benign Het
Pramef12 G T 4: 144,395,122 H111N probably benign Het
Prr22 T G 17: 56,771,884 F346V probably benign Het
Prr30 T C 14: 101,198,775 N117S possibly damaging Het
Ptgfrn A G 3: 101,077,361 S172P possibly damaging Het
Ptprc C T 1: 138,111,188 V364I probably benign Het
Ptprz1 T C 6: 23,000,991 S1027P probably damaging Het
Rinl T C 7: 28,792,271 V83A probably benign Het
Ros1 A T 10: 52,118,381 S1268T probably damaging Het
Scly T C 1: 91,298,450 probably null Het
Slc25a1 C T 16: 17,925,848 V186M possibly damaging Het
Stk36 T G 1: 74,626,144 probably benign Het
Syn2 A G 6: 115,274,229 T449A possibly damaging Het
Tecpr1 T C 5: 144,214,063 D309G probably damaging Het
Tns2 T A 15: 102,112,023 Y775N probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ttl G A 2: 129,081,270 G177D possibly damaging Het
Twf1 A G 15: 94,586,519 S41P probably damaging Het
Unc79 C T 12: 103,146,366 T2174M probably damaging Het
Vangl2 T A 1: 172,008,546 K340* probably null Het
Vmn2r72 T A 7: 85,738,341 T672S probably damaging Het
Vwa7 A G 17: 35,017,211 D47G probably damaging Het
Zc3h12d A G 10: 7,867,459 H331R probably benign Het
Zfa-ps T C 10: 52,545,016 noncoding transcript Het
Zfp141 A T 7: 42,475,225 C608S probably damaging Het
Zfp422 A G 6: 116,626,642 I132T possibly damaging Het
Zfp652 A G 11: 95,750,023 Y258C possibly damaging Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1676:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
R7561:Ncam1 UTSW 9 49564942 missense probably damaging 1.00
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGTCCCAGGTTCTGTG -3'
(R):5'- CCAGCTAAGGCCGAGTGAG -3'

Sequencing Primer
(F):5'- CCCAGGTTCTGTGTGTGTG -3'
(R):5'- CCGAGTGAGGCAGCCAAG -3'
Posted On2014-10-30