Incidental Mutation 'R2291:Ints7'
List |< first << previous [record 93 of 217] next >> last >|
ID244321
Institutional Source Beutler Lab
Gene Symbol Ints7
Ensembl Gene ENSMUSG00000037461
Gene Nameintegrator complex subunit 7
Synonyms5930412E23Rik
MMRRC Submission 040290-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R2291 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191575636-191623688 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to G at 191606203 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000194785] [ENSMUST00000194877]
Predicted Effect probably null
Transcript: ENSMUST00000045450
SMART Domains Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461

DomainStartEndE-ValueType
SCOP:d1gw5a_ 76 530 1e-10 SMART
low complexity region 937 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193961
Predicted Effect probably benign
Transcript: ENSMUST00000194785
Predicted Effect probably benign
Transcript: ENSMUST00000194877
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,413,801 I247N probably damaging Het
Afdn A G 17: 13,888,891 K1559E probably damaging Het
Ankhd1 C T 18: 36,644,333 T1523I probably benign Het
Apc T A 18: 34,312,491 N795K probably benign Het
Arhgap26 G T 18: 39,357,698 probably benign Het
Atm C T 9: 53,490,909 probably null Het
Atp1a4 T C 1: 172,244,906 N394D probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Cacna1d G T 14: 30,042,342 R2078S probably damaging Het
Cacna1e T C 1: 154,403,683 D1720G probably damaging Het
Camk2a T A 18: 60,963,959 V38E probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccr7 G A 11: 99,145,335 R254C probably damaging Het
Celf5 C T 10: 81,467,047 G267D probably damaging Het
Cfap65 G A 1: 74,926,475 P459S probably damaging Het
Chd1l T C 3: 97,591,283 K267E probably damaging Het
Chl1 T A 6: 103,715,393 Y331N probably damaging Het
Cltc G A 11: 86,733,622 T158I probably benign Het
Col16a1 T A 4: 130,067,040 D430E unknown Het
Cspg4 T C 9: 56,892,743 V1597A probably damaging Het
Cstf2t T A 19: 31,084,864 L600H probably benign Het
Cyp27b1 T C 10: 127,048,294 V5A possibly damaging Het
Depdc5 C A 5: 32,979,402 Q1339K probably damaging Het
Diaph3 G T 14: 86,966,446 P592Q probably damaging Het
Epha8 T C 4: 136,933,347 M687V probably damaging Het
Fhod1 T A 8: 105,336,964 probably benign Het
Gls2 C A 10: 128,207,610 S73* probably null Het
Gm3604 T A 13: 62,371,843 M33L probably damaging Het
Gpr39 A G 1: 125,677,541 T69A probably benign Het
Hal T C 10: 93,503,536 F496L probably damaging Het
Hipk1 T C 3: 103,761,610 E490G probably damaging Het
Itpr3 A G 17: 27,113,579 E1799G possibly damaging Het
Kif11 T A 19: 37,407,003 M570K probably benign Het
Kif18b G T 11: 102,908,270 Q702K probably damaging Het
Kif19a A G 11: 114,790,193 T247A probably damaging Het
Lama3 A G 18: 12,525,079 E360G probably damaging Het
Loxl3 G T 6: 83,037,488 A126S probably benign Het
Mc5r C T 18: 68,339,364 R265W probably damaging Het
Mpl A G 4: 118,449,000 V340A probably benign Het
Mrpl13 G T 15: 55,548,219 H56Q probably damaging Het
Msr1 T C 8: 39,624,222 T116A probably benign Het
N4bp3 T C 11: 51,646,103 K48E probably damaging Het
Naaladl1 A G 19: 6,106,195 T104A probably benign Het
Neu1 C T 17: 34,932,766 R179W probably damaging Het
Olfr1053 A T 2: 86,315,180 Y35* probably null Het
Olfr975 T C 9: 39,950,334 T146A probably benign Het
Osbp G T 19: 11,973,834 E248* probably null Het
Otx1 T A 11: 21,996,634 probably benign Het
Parp4 A T 14: 56,613,817 Q759L probably damaging Het
Pax6 A C 2: 105,685,883 S169R probably benign Het
Pigg T G 5: 108,332,917 I389M probably damaging Het
Pla2g4a C A 1: 149,901,189 V59F probably damaging Het
Plcb4 A T 2: 135,939,983 Q241H probably benign Het
Plpp6 A G 19: 28,964,320 D107G probably damaging Het
Ppp6r2 T A 15: 89,275,487 L459Q probably damaging Het
Prss55 A T 14: 64,075,722 W238R probably damaging Het
Rgl1 C T 1: 152,536,281 E446K probably damaging Het
Ric3 C T 7: 109,038,883 G221D probably damaging Het
Rnf167 T C 11: 70,649,303 F83S probably damaging Het
Ryr1 C T 7: 29,098,777 V947M probably damaging Het
Scn1a A G 2: 66,288,968 L1397P probably benign Het
Sh3bp1 T A 15: 78,918,319 V251E possibly damaging Het
Slc25a10 A T 11: 120,497,074 I198L probably benign Het
Smoc2 A T 17: 14,368,971 N234I possibly damaging Het
Spdl1 T A 11: 34,819,309 K382* probably null Het
Ssrp1 G A 2: 85,042,316 probably null Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Triqk T A 4: 12,974,817 probably null Het
Ttc19 T C 11: 62,283,693 Y128H probably damaging Het
Vmn1r15 T C 6: 57,258,692 S182P possibly damaging Het
Vmn1r226 A G 17: 20,688,213 I236V probably damaging Het
Vmn2r120 A C 17: 57,509,479 N625K probably damaging Het
Vmn2r78 T C 7: 86,920,154 I85T probably damaging Het
Wdr60 A T 12: 116,229,571 probably null Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt7a C T 6: 91,394,486 V165I probably benign Het
Zbtb40 A T 4: 136,985,017 Y1127N possibly damaging Het
Zfyve1 A T 12: 83,547,931 H762Q probably damaging Het
Other mutations in Ints7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ints7 APN 1 191596164 splice site probably null
IGL01285:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01289:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01572:Ints7 APN 1 191615793 missense possibly damaging 0.71
IGL01665:Ints7 APN 1 191613219 splice site probably benign
IGL02059:Ints7 APN 1 191615760 missense probably benign 0.23
IGL02684:Ints7 APN 1 191613637 critical splice acceptor site probably null
IGL02686:Ints7 APN 1 191586592 missense probably damaging 1.00
IGL02812:Ints7 APN 1 191619741 missense probably damaging 1.00
IGL03119:Ints7 APN 1 191610365 missense probably damaging 1.00
IGL03162:Ints7 APN 1 191621412 utr 3 prime probably benign
R0294:Ints7 UTSW 1 191611891 missense possibly damaging 0.91
R0479:Ints7 UTSW 1 191614554 intron probably null
R0698:Ints7 UTSW 1 191594464 missense probably damaging 0.97
R1420:Ints7 UTSW 1 191613057 missense possibly damaging 0.73
R1680:Ints7 UTSW 1 191621162 splice site probably null
R1781:Ints7 UTSW 1 191596284 missense possibly damaging 0.95
R2141:Ints7 UTSW 1 191604860 missense possibly damaging 0.73
R4718:Ints7 UTSW 1 191583277 missense possibly damaging 0.60
R4741:Ints7 UTSW 1 191619635 missense probably benign 0.29
R4797:Ints7 UTSW 1 191596933 missense probably damaging 1.00
R4812:Ints7 UTSW 1 191594430 missense possibly damaging 0.73
R4826:Ints7 UTSW 1 191611906 missense probably damaging 0.97
R4870:Ints7 UTSW 1 191596331 missense probably damaging 0.97
R5169:Ints7 UTSW 1 191613090 missense probably benign 0.00
R5281:Ints7 UTSW 1 191615771 missense possibly damaging 0.90
R5694:Ints7 UTSW 1 191586618 missense probably damaging 1.00
R5752:Ints7 UTSW 1 191575893 missense probably benign 0.00
R6048:Ints7 UTSW 1 191621412 utr 3 prime probably benign
R6341:Ints7 UTSW 1 191613127 missense probably damaging 1.00
R6419:Ints7 UTSW 1 191602302 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGTGTTAAGGAAGGTATCTGAAGAT -3'
(R):5'- TGTACAGCCCACTATACTAAGTCC -3'

Sequencing Primer
(F):5'- ACCACCCAGCCTAATGTT -3'
(R):5'- TAGCCTTCACATTGTACCAGAGG -3'
Posted On2014-10-30